Transcript Name :
Plaha_PHALS_04736
Orientation:
(+)
Number of Exons:
1
Description :
endo--beta-
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-752
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2259 bases(100 bases per row)
ATGATCCCCCCTGCGTCTTCTTGTGCCAAGTTTGGATCCCCCACACCCCCGCCGCCAGTTTTCCGATCAACcgaagacctgcagaaactaATTTCACCTA
AATTTTTGTCTACTCATGCTCGATTGAGACCCGTTCCGACAAATGAGTGGTGGGGTAACTTGCTGGCGTGGGATGGACAGCGGGATAGCGATCCCGTATT
TTCTGGTCCTTATACTTACAAGGTAGTACCTAGCCAACCCGGTACGATTGGCAGCGGCTTGTCTGTAAGCTATTTGGTACAGTACCGAATGGACGGCCCT
TTGAACGACAATGGAGCTCCTCGCTTCTACTGCCACCAAGCAACAATCAAAAATTGGATTTTCTCCTCTGTCGAATTGGCAAGACAATCATCGGCGATCC
CACCACTGAGCATCGAGGCTTGGGATGATATGGGCGTCCACTTGTCTATGAGTGGAATGAAAATGTATTTGTCCTTGGGCTCAGCCTACACGACGGTCGA
GTATCGAGATGTACAGGTGCAACTCGGTACTGAGCATTGCATTGTCGCTATTAATGGAGCTCCAGTGCGAGAAAATTCTGAAGTGAATGGCGTCAGCTTT
GTCATTTCGCTTAACAATGGCCAATTGTGGGTACTCTACTTTTTTGCTGACGCTAGCAAAAACACATCTTTGGTTTTCAAAAGCAACAAGCTTACGACAG
CTTGTAAATTTACGGGCGTTGTTCAAGCTGCATTTGTGTCAACGAGTGCTGTTCCGTCATCGATACCTCAAAACGACCACAAAATCTTACAGGTTTATCA
CGCTAGTGCTGGAATTTATCCTAGGGGAGCATTTGTTGAGACACTTTCTTCAGAGTCATTTTCTTTTCGCTGGCAACTTGTGCAAGCTTCAGGAAGCAAT
CCAGGAGCACAATTCCTACATTTTGCACTCACTCACTTGCACGCAATGCTAGACAAAACGACAGTTGAACTCAAACCCGAGCTCGTGTTGCATTCCCACA
CGCATGGGCCATTGTTTGCCTACATGTTGATAACTTCAACAAACTCAAACTCAATGTGGATTTGCCATGTGTCTCAAGCTGAAAGTCAAGCAGTTGAAAC
GTGCACTTCCTTCTACCCGCCTCGTGCTGGCTGCCTTACGCGCGATATGGTCGACAGACTAAAGTTGTGTCGTATTGTCACCGATGAAATCTATGAAGAC
TGGTGCCTTCCTAATGAAGGGAGCTATTATTTTAAGGGTAAAGCTTTACAAAAGTTTGGGACCATGTGTCTTGTGGCTAGGCAATTAGCCGACACTACCA
ATCCGGAAATGCAACACGTGGCGCAGCACGGCATTTCAAAGCTGGTGCAATTGATGTCGCAATTTGCAAACAATCAATCAGCCTTCCCTTTAGTCTACGA
CACGGTATACAAGGGAATAATTTCAAGCGAAGCCTTGGCCAGGAATGACATCAACGTTGATTTTGGGAATGGTGTCTACAATGATCACCACTACCACTAT
GGCTATATTGTGACCGCAGCTGCTATGACGCTATACTTGGACCCACATTGGCGTCACTCAGCCGATGCCGCCAAGCTCCGAAGTATTGTTGATACCCTTA
TACGAGACGTAGCTACATCGTCGCCTGGTGATAGTGACCCTTACTTTCCACGTTTTCGATATTTTAATTGGTGGCTAGGCCATTCGTATTCTCACGGTGT
CACTCCAATGGCTGATGGTAAGGATGAAGAGTCGACGTCTGAAGAGGTCAACTTTTTATATGGTTTTGCTTTATACGGCCAAGTCACGGAGGAtcaggag
cagcagcggCTGGCGAAGTTAATGCTTAAGGTTTACGTGCACGCCGTCAATACCTACTTCTTGCTGCGAAACGATGGTCCTGTGATTCATCCCGCCGGCT
TTGCCCGAAACAAGGTTACAGGTGTCTtttttgacaacaagtgcGACTACACGACGTGGTTTAGTCCTAACAAGGAGTGTATACATGGCATTCAAATGAT
ACCCGTCTCCCCGATCCTTGAAGTTTCCAGGGCTCCTCAATTTGTTCGTGAGGAATGGGATGAGGTGTTGCACAAATTGCCCATAGTGCACGACTGGAAG
GCCAATCAAAGTAGCTGGACGTCGTTGTTATTTACCAACTACAGCGTTTTAGATCGTGAAAAGGCGTTTAAAGTGCTAAAAAAGTGCCCCATGGACGACG
GACTTAGTCGTGCCTGGGCGCTTTATTATGCCGCAACTCGACCGCCCCCTTTTTGCTAG