Transcript Name :
Plaha_PHALS_03059
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5730.61921
InsideOutsideTMhelix
1-328
NN-scoreoddsWeighted Score
0.5971.3780.003
*** None ***
TypeScore
cytoplasmic304
GO
*** None ***
*** None ***
*** None ***
Sequence
        5299 bases(100 bases per row)
ATGTTGGCAGTAGCTGTCGCGCTTTCCGGCTTCACTATTCATACTGCTGGTGCGAATGCGAACGATTGTGAAATGATATACAACGGAGTGAAAGTTGATG
GAGGAGCAGGCGCAGGTCTAGTTGTGAAAGCTGGAGGTGGTGTAAGCGCTGGTGTTGGTGCAGATGCCGGGCTCGGTGTTACTACTGGTCTTGGTGTCAA
AGCTGATCTTAATGTCAAAGCTGGTCTTGCTGGGGGCGCCGGACTTGGTGTGAAAACTGATGTAAATGTAGGTGCGGATGTTGGTGTTAAACTCAGTGGT
GGCGTTGATGCTGGTCTCGGCGTGAAAGCCGGTCTTGGTGTCAGTACTGGTCTTGGTGTCAAAACTGGTCTTGGTGTCAAAACTGGTCTTGGTGTAGACG
CTGGCCTTGATTTGAAAGCTGGTCTTGGTGGAGGTGTCGGTCTAGGTGTAAATACTGATCTCGGCTTGAAAGGCGGGGTCGGAGTAGGCGCTGGTCTTGG
ATTGAAGTCTGGTGTTAGTGTCGGAGCTGGTGTTGGTGTAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACtacaggcatagcctcgaggcggacgtcgccatcttcctcccccgtcatactgttgacga
gattgtataactgtgcaacgtcgtctacggtagacacagcctggatcagggtcgacgcctggcgtcttgcagccagcattcGGCGTCGCCGTCCCCTCTG
ttcagaggttctatgtctccgtgagaccagggtgaacacgcatctggtgtcaccctcactttccacgccattggagctccgatgttatctacaacatccg
acgaagaactaaTAACCCGCAATCTCCGTCCAGTGGACAACGAGCCACTCCAAGCGCATCtcaagggccgtgcccaagataccTCGGccctctgtccgac
cacgccctcattggcatgcagcgactgctttgatactcgagcagcgctcagtagttTTTGTGCCACTTCATATGCATCACGAAGGCAtcgccctcgatgt
ctcggcccttggtcgaccatgtcacgcattacatgcagcaactgctccaaaacttgtGCATCAcccagtgggttacgtaccactccacgatcagcccgcg
agccacgctcgggactcctgttcaATACAccattggtgtctaccaactcggaaaTATCAacgtctagcacgttgaccgtcttggtccagtgctctcgcca
ataacgcttttgtctcctagtaGAGGTGGCTTCATGACTCgctaaagctccaccaagagacgtgcgcgtaatgCAgagattctatgtctcggtaagACCA
GAGTGAACACGCATTTCGCGTCGTCTGgagtcaccctcactttccgatcctttgagctccgatgttatccaaaacatccgacgaagagctgccaaccccg
cagtctttgtccagtggttaacgtgccactctaagcgcatcacgagggcctcgccctcgatgcctcggcccttagccgaccatgtcacgcatgacatgca
gcgactgctccgattcTTCAGCAGCGCtaagtgggttacgtgccacctcACGTGCGTCACGAGGATTTCGCCCTCAATACCTCAgctcttggccgaccat
gtcacgcatgacatgcagcgactgctccgattcTTCAGCAGCGCtaagtgggttacgtgccacctcACGTGCGTCACGAGGATTTCGCCCTCAATACCTC
AgctcttggccgaccatgtcacgcatgacatgcagcgactgctccaaaacttgagcagcgctcggtGGGGTTTGGGCCACTCCACAATtagcccgcaagc
cacgctcgggactcgtTTTcgatacacctttggtgactaccaactcggacattccaatgtctagcacgttgaccgtcttggtgcagtgctctcgccaaca
gcgcttttgtctcctagcaaaggtgggttcatgacacgCCAcagctccaccagaagacgtgcgcgtagcgcccaaggtctttgacctccaatcaatccat
ataTCATGGTTTTcctaccatgccattcccaagatgaggtcataccttgtatccaagtctaaaactagaaagcgttccacgctatcaaagtcaaggaact
tgacttcaaggtccacagggaccttcgggaccgtgtcACGTGTCATCGTCGCTAGGCGagtagtgacgatgtcatccGATcgcactttcagcgcctcagc
atacagctgacttccctctatcgtggagcgtcgagcataattgcccgacgccccagaatcaatgatgatcttccatggcttctcgaagacctttacggtc
gcctctaagaccagcaagcccggcttactTACACGTTTCGTTTTcaggagcacggagctcttcggggctaagCCCTTCTGACCTATGCCCCCCTGAGGCT
agacagaactcagttctttcccagtaggtcgccccgcgcctactgagtggtgtcgttcccCCGCGACAGGCccgactggtaggcgttgatGCAATGGTTT
AAAGAACtttgatgcgccttgcgcagggggcaaccgttccgcagatgacgggtgtcttcacaaacaaaacaccgtcgtgtttgtgtgctgcccggtagCT
CGGAGTTctgcttcctcgtcctcagcatggctgagtccatgggcacaggaccgctcgacgagttgttggagtgtgcattccaaccaagtcgtgccgacct
gaaattaaattctgcattcaatgccacaatcACcgactcttcaaatgaagacggatgcacacggaagacctccattctggccacgtcaGTGCGgtggcct
tccataaagacggtcactgtgaccacctTCGGGAGGGGATCCGCTCCCATCACAAAAACACGCTGCTAgacagaagatgtctgcatcattggcgtctatg
acgtcacCGCTAGTAACGGATGAcctccccgccctaagccgctcatggtgagcgttaaggtgtctgaggggaaggatggagagaatctcatgCTGTGGGT
GAGAGATGTCGAGATGGTCATCTNNNNNNNNNNAGACTGTGGTGTTTACTGTGCCCAGGTTCATAGCACCCCACTCAGAATACTTACTGTCGAAACCAAG
CAGAGCACTCATTCCTAATATTAATTAATCGTACCATCAATGTCTGTCTATTATATAGTAGGCAAAACGTTGGGGAANNNNNNNNNNtggccttgacctt
agcgggatccgctcgaaggccacgctttccaatgaagcaccctaacaATGGAATCTCTTCtccgccaaagatgcacttgtctgcctTGGCGTACGGTATG
TTagtgcgcatacactcgagcaccgctcttaaaaaGACGATATgtttctcctcatccgtactcccgtgctccgcacgactgtgaacgaaaatgtcgtcaa
agtatgaatGTGCATGcaccctgtggggcctgaattaaagcgtcacaagatgattaaatgttgctggtgtatttagcagcccttggggcatcaccagcca
cttccagagcatcccgctcggcgtgcttaccgctgtcagcggaatgtcactcgctctcatgagcaattggtagtatccatctaccaaatcgagtgcactg
tacatcGTACATCCCAACGCGTTGTtccgaagaacatcctttttaggaattggcgtctgtgctgaaatggtggcagctttgagcttattgtaagcatgaa
cgatacgccacttgccgttcactttcgaacacaaaacgtggggaGATGTACCATCTCGCGTCGTTctttgcacgaaaaaagaagtcaatgacgTGGGTAA
GGGCCATTGACGtgctacgcagtatttgattcccggaaccaggtcgatttcaagacgcacacctcggtcccgaggtaggaccgaagatgtgtctttggag
acgacgtcttgaaatttctttaccaaaggatagtacggatccaagtgatttcgtaggatcgacgatccacttcgtgctttcagcactctcttggtgtctt
ccaagacacctttatccagaagcgatggcgAGTTtatcgtccggtcgtacaatgaccacttcggccaaatcgcctgccttcaaggcactgccgaatcCTT
CAANNNNNNNNNNACTGGTCTCGGCTTGAATGGCGGGGTCGGAGTAGGCGCTGGTCTTGGATTGAAGTCTGTTGTTGGTGTCGGAGCTGGTGTTGGTGTT
GGAGCTGGTGTTGGTGGAGACGCCGGCCTCGGTTTGAAAGCCGGTTTTGGCGCTGGCGTCGATCTCGGTGTGAATACTGCTCTTGGAGGCAAAGCTGGCC
TTGGTGTAGGTGCTGGTGTTGATGCTAAAATTAGTGGCGGCGTAGGCGCTGATCTTGGATCGAAAGCTGGTCTTGATGCAGGTGCTGGCCTTGGTGTGAG
TCTTGATGCAGACGCTGGTGTTGCTCTCGGTGTAGGTGCCGGCCTCGGTGCGAAAGCAGATCCTGGCGTTAAAGCCGGTCTTGGTGCTGGTGTCGGGCTT
AAGGCCAATTCTGGTCTTGGTGCAGGTGTAAGTTTAGGTTCAGGTGTTGGTGTGAATGTTCGCCGTCGCCTGCGCATAAATTATTTGGCGAGTGTTTGA