Transcript Name :
Plaha_PHALS_07339
Orientation:
(-)
Number of Exons:
1
Description :
myotubularin-like protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Myotubularin phosphatase domain102.659PS51339
Protein-tyrosine/Dual specificity phosphatase9.032PS50056
HmmSmart predictionP-Valprediction_id
Protein-tyrosine phosphatase, catalytic9.9SM00404
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Protein-tyrosine phosphatase, catalyticIPR003595
*** None ***
InsideOutsideTMhelix
1-1161
*** None ***
*** None ***
TypeScore
nuclear652
GO
Biological ProcessGO IDPrediction Method
phosphatase activityGO:0016791IEA
KO ID
K18081
K18081
Cluster Id
1204
Sequence
        3670 bases(100 bases per row)
ATGCACGCTCGGGAAATGCCGGCGTCCATGACGACGGAAGTCCCTGCTGACGACCAGGACGACGCGTACTTGGCCCAGCGCCAGTCCACGATGGACTCAA
CTACGCTTGGAAAGTTGCTAATGGCTGAGAAGAATTTAGCACAAGCCGGCCAAGCCACAACGAACGTATGGAAACTCATTGGCAAGCTACCAAGCGAAGA
GAGCGAGTCTCCACCACCTGCTCCGACCGCAAACCTATCTGGTAGTCATTCCATGCCTTTACGTCAAAATCTTAGGTCCATAATTCACTTTTCTGCTTCT
CAAGGAGCTGACTCTAGTCCTATACGTCACACAAGGACACCTTCTCGACGGAAAATATCAATACAGGGCTCAGACGACTTTGTCGCCGGCAGATACAAGT
CAACGGGACCCCCAAGTCCCTACGGTGGCAATAAGTGGGCTGCAACAGCTCCGTCAGGCAGCAGAACGGATTTGACTTTTGACATGACCGACGCAACAAG
TGTAGAGGCCCGTTTAAGCCCAAGATACAACATGGAGATCCCACGTCCGGACATGGCAGTAGGACGCAGCTCGCTTGGTAGTTACGGTCACAGCAACAGC
TTTTTTGAACGACCTGGACACTCTGGCACTTCCGGAGCGCGACCGACCGACATGTTGAGCGATCCTAGCAATTTTTTAGTGGAAAACGGTCGCAGTCGAT
CTACACATAGCAGTAATGTTTTTGGCTTTAGTCGCAATGCTGCACCATCGTCGGAAGTGACGCGGTTTACGTTTACCGTCAAGAAAAGCGATAGTGTTTT
GGAAAAACTTGGTAGTAAACGTGCAAGCATTCAACTGCAGGTGGACGTAGATGAACGAATGCTTTATTTTCTATCTGCACATGACCAGCGCGAAGAGTAC
AGTTGTGCAGCTGTTACAGCCAAGCCACAGTCGAGACTTGGGATGCAACTAAAGATCCAAACGGGAAATGCTAGTGTGAACAAAAAGATTACGTTTTATA
GTACAGAAGACAGGGCAAATTTTGTTCAGGCATTAGAGCAGGGCAAGGTGATGCTCAACAAAAAGACGTCTACGGCAGCCACACCGTCTCGTATACCCTC
TGAGCCAGCTGACGAGGCAATGACAACGGTCTCTAGCACGGTCGAACGCTCCAAACTCCGGGACTCACTCATAAGCGATCACTTTCAGTTGCTTCCAGGA
GAGTCGGTCTTGGAACATGTGCAGCGTGTAACAAATTTAGTCGTGATGTCTCAGAGTGACCGTGCAGTACAAGGCGTGCTGAAGATCACATCGTATCGTA
TCACATTTGTTCCCTACGACGCGTCATGGAAGTTTGGCTCGTTTGAGTTACCACTTGCAGCCATCGACGTCATAACACGGGACGGGCTCATGTTGCTTAT
TTCGTGCAAAGATTTGCGTACTTTGCGACTCGCTATGCACGACGCGTACTCTCGCAAGAAAGGATACGACCAGCTGCCATCTACTCCAGACTTTCGCTGG
CTTAATTTGCTTACGTTGCGAATGAAGCCCCCAAATATGATTGGTGCTTTGTTTGCATTTGATTACCACACGGAAAAGGCCAAATTACGTGGCTGTCCAA
TTTCCGAAAAGCACAATGGATGGTTTGTGTACTCGCCTTTTGCTGAATACCAGCGTCTTGGCTTTCTGTCAGCCAAAAAACAAACGGAAGACGATGGAGC
CATCACGTGGCGCCTTCTAAAGAATTCCAAGTTTCGATTCAGTCCCACATATCCCCAGCTGATGGTTGTACCGTCTATCATGTCGGAGGAACAGCTTGTG
CAGTCGGCTCGCTTTCGATCCCGCGCACGCTTACCAGTTGTCGTGTGGCGCCATCCCGTGAACAAGAGCGTTTTGTCTCGCTCAAGTCAGCCGAATTACG
GCATGGCAGGCAATCGATCCGAGCCAGATCGGATACTTTTACGCGCGTACCGTGACTCAGCTAACAAGAATAGCTCCAACATGGCACCTCCTCTTCACAT
AATTGATGCCCGGAAGCCCATTGCTACAAAAGGAAATCGATTAAAAGGAAAAGGTAACGATGAAATTTTCGAATATTACGATTTAATACTGACTATCATT
TTTTTAGGTGTGGAAAATTCACAGCATTACGACAACGCGACCATTGAGTTCATGGGAATCGCCAATATCCACAAAATGCGCGAGTCGCTAGATGCTTTGA
AATGTACGTCTTTGCTCCCTTTTGAAATTGTGATGTATCAAATTTAACTTGGTTATCAATCGATTTAGCTCTTGTTAGCCCAAGCAGCGTTGAAGATGGA
GACAAACATTATCACAATCGTCTTGAAAGTGAGTTTGCTTTACAATTGCATATGTGCTCGCGCTGACATGTTGTAACGCTTTAAATTATTAAGACACTCG
ATGGCTCAAGCACGTTATGCGCGTGCTATCAGGTGCCCGTAGGGTTGCAGAGGTGCTACATGAAGATGGCGCGTCAGTCTTAGTACATTGCAGTGATGGC
TGGGACCGCACGCCACAGCTTGTAGCGTTGGCACAACTCATTCTCGACCCATTTTACCGTTCTATCCGTGGATTCGCCAGCCTTGTAGAGAAGGAGTGGT
GTTCCTTTGGACATAAGTTTGCAGATCGAATTGGCGTGGGAAAGGATATAACTGACCAGCCAAACGAACGATCACCTGTCATGTTGCAATTTCTAGATTG
TGTATGGCAAATGACGCGACAATTTCCGGCGTGTTTCGAGTTTAACGAAAAGTTTCTACTTCACATCTCAGACTCTCTCATTTCTGGTCTATACGGTACA
TTCTTATACAATTCGGAGCGAGAGCGCGTGTTAGATAAAGTATGGGAGCGCACTGAATCGGTATGGACGCCAGTGTTGGAGAATCCAACACCATATAAAA
ATCCTCTTTACCGTCCAACAAATCGGGTGCTCTACCCTCGCGCAAATCTGAAACGTGTTGTTTTGTGGGATGGTATGTTTTTCCGGTGGGATCCAGAAAG
TCATCCCGACTATATGGAGTTTATGGACCCTGTAGAGAAGCCTGACGATGACACTTCAAACCGCGGCTCTGATGAAGATGGAAGTCCTCGCGATACTTGC
GTCATGGACGCCCCTTCTGTAATGCCCATTGGTGGCAATCTGGACGAAGACAAGGTGGAGTTACAAATCGACGTGATTCACGATTACGATGAGCTTCGGA
CAAAAACGCTGTCGGATTGCTCAGACATGAGcgacgacgacgacgacTCGGAAGAATCGGCAAGTGTGACAGCACGTTACGATGGCTTGTCGccacttac
agcagatgaGCTCAATATGACAATGCCAGCAAGTAGTGACGTCGATTTAGTGGCAGAAAATCGATTCGCTATTGACGCCAGCGTCGTCGATCGATATCAT
CGTGGGGTGGAGGAGCGCACTCGCCAGCGCGCACAGGGTCGCAACATTCGCGAAGCTTTGTTGTTGGCTCCTGATCAAAGTCGCATAAAATATTTGGAGC
AATTACTAAGCGAGAGTGTCGCACGAGAACTGCAGCTAGAAGCAGAGTTGGATTCCGTTGTGCATCGTGCTGCAAGGGGTCCAAGCAGTGCTTCAAATGG
TAACGCCACTGTGCCAAGTGATGGCAGTGTAAATGACGGATCAGCTCACTCGCAGTCAGTTGATCGCTAG