Transcript Name :
Plaha_PHALS_13633
Orientation:
(-)
Number of Exons:
1
Description :
voltage-gated ion channel superfamily
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Potassium channel1.2PR00169
Potassium channel1.2PR00169
Potassium channel1.2PR00169
Potassium channel1.2PR00169
Potassium channel1.2PR00169
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-132
202-213
271-281
334-344
751-762
805-832
156-181
234-247
302-310
368-727
783-786
853-1218
133-155
182-201
214-233
248-270
282-301
311-333
345-367
728-750
763-782
787-804
833-852
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
potassium ion transportGO:0006813IEA
*** None ***
*** None ***
Sequence
        3966 bases(100 bases per row)
ATGCTTCCGTTTGCCAACGTGGTCGATGACCGAACAAATGGAATCAGCTGTGAAAACGAGAAAAGGGAGCAAAACGAAGCAAATCAAGTAAAAAGATTGT
CACATCGAATTGTGCATGACGAATCACCAACCGGTGACACTACAACTCTGTCGTATCCATCCATCATGAATGTCACCCTTTCAACAACAGAAGTACAAGC
GACAAAGCCCCAGCTCGTGGAATCAGCAATAGAAAACTTTTATCCCGATAGAATTAAAACGACAATCTCTATGTTTCTAAACGCCATGGTGAAATTGACT
ACCCGCGATCTCCCGTTACGACATTCTCCACGTTTAATTCAGGCAATGGGATGGCGAGAACGTATTTGTTTCTACCTCACAAATCCCGAGAAATCATATA
TTGGTTGGCGACTACAGCAAATTATCATGTTTTTGCTTGTCATCAATGTTGGAGTCATGGCGAGCGAAACCCTCGATGGACCGCAGTACGGTAGTACAGA
CCCTGCATTCGCTTACATGCTCAGTGAAAGTGCTTACAATGATATCGAGACATTATTCTCGCTACTGTATATAACGGAATTTCTCGTTCGCTGGTACACA
GTTCCGAAACGAATTCAGTTCTTGAAATCAGTCTCCACATGGATCTACTTTTTAGCCGCAGTAGCAGCACTACCAAAACTAGTATTGCCAACACAGAACA
AGCAATCGGATACAATGCGAACGGATTCAATATCGTATAATCTCCGTATTCTCCGCGCAGTTCGTTTAATAGTTGCGGTCGCTCCGTTTGTTGGAACTAA
AGTGCTCCTACGCGCCATAGCTGAGGCAATCGCTCCCCTCAAAATTACGGTGCGCTAAACATTTGCTCGCATGATAGTCTGTTTTGCTTTAAGCTTATAT
AAGTTGTTTTCGCTTAATGTCAGCTTTTCTTCTTGATTGCCGTCGTGATGGTGTTTGCTACGGCCATTTTCTATGCCGAACCTTGCTATGATTTGCAAAC
CTGCACATTTACTGATATCTTCAATACGGGATACTTTGTTATGCTCACGTACGTTTAATCTCATTATGTCCATTCTACTTTTGATACTAACATGTTCACA
TTCTAGTGTTTCCACGGTTGGGTATGGAAGTCAAGTGCCTTCGATGAACAATTTCGGTTCTCTGCTACTTGTATGTCTCGTGATGATCTTTGGCACTATT
TACTTCTCAATGCCTCTGGCAATCGTTGGCATTAAGTATGacttggcatggttggaccaTGACGAACATCTTGCTAATGTAAAGCAGGAACAAAGCAGAT
TGCAAAATGATTGTACAAGTTCAGAGCCTGTTTCGTCTGGTGACGTCTtacgacctcaaagttttgacGCATATGATGATACAACGAAAAAAGTGGACGA
TACACTCGAAAAGGTCGAAGCACATGTAATTCAGTATACAAGCTTAGTTACGAGCGATCGATTTTACACACTGTTACAAGGGCTTTTCGATGCCAATTCA
ACGCTTCAAGGTTTGCTATCTCCAAATGAAAACGCATTGAGCTCTTCCACGACACTGGAGTCTCTAACTCAAATAAGTAAAAGACGTAATGATAAGATGT
CGCAAGCGGTAGATGTGATGGTGAAAGTAATTGAAGTTCACTCTAAAATCTGCTTACAGACTCAAGAACTACTGGAAGCCTCTACAGATCGAGAGAATGA
TTTTAGTCGATTTATGTCGACAAGCAAATTTGAGAGCAAGACTATCAGTGGTACATTGAGCAAAAGAATGATCCGCGCGAAAGGAGCAATCGACGCAATT
AAGACCAAGGCTATGAGTGCTATATCTCGTCGTGATAGCCACACTAATCCCAACAGCTTCCGAGCTTATATTTGGAACGTACTTGAGTACCGTTTAGATA
CGTGGCACTCACGTGTGATTAACAAAACGCGCATGATTGCAGTAGTGCTCAGTATTGCAATGTTTTACATGCAAACGACGCCGGAATTGCAGAATACAGG
AATCAAAACATTTCTTTGCTTGCGTAATGTTTATGATCATTGTGAACGATACGATGAGTTAGGTTGCTACGTGTTTCGACAAATTTCATCGTCTGGATCG
GAACTTTCGGTTGAAGTAACAACACAGCGATTGAGCCGTCACTGCTCCATTGGTGACAAAGATGAAACGTGTTATGGGTCAGGTGTCAATTTTGCATCGG
AGAATTTTCCTTTGGCTTGTACTGACGTCTTTCCGTCGCGATCCGGTATCGAGCACGTTTGCAAAAATcgattgtgtaatccaccaGTGCTTTATCTGTT
TGACATGGAGCCATACTGGATCTACTTTGAAATTCTCTTTGGCTTCTTATTCACATTAGAAAGTGTCATGCGTGTTTACGCACATCctgtgcgacgtcat
ttgtGGGGTGATTACAAGTTAATGGTTAATGTTCTCGTACTTCTCCCATTTTACGTTGAGATCGTCGAAATTATGATAGGAGAGTGGCCAACCTACGCTG
TCGGACCAGCAATACCTTCGTTCTTTACTGCTGTTCGAATTTTAAAAAGTTTGCGTATTTTGAAACTGGGAAGTCACATTCCAGGTGCTCGTGTACTGAT
TCAAACAGCGCAATTAGTCTCAGAACGACTAGTAATCCCGGTAAGCTCTATTGAACTCATTAATTCACAACCTACCCAATCTTACTTTTTGATTGTAgct
tttcttcttgtttTTAGGCTGCGTCATCTCTGCGGCTGTGTTTTTTGAATTAGAGCGTGGAACAGAGTGTTTTGTTGGTCAAACGTGTATGTGGTGGCAT
ATAAATGTTCTAACGCCGGAACTGTCAGAAGGTTTGCCGATTGGAAAGCGTATACTGATCCAAAATACACTTCCTAGTATCATAACCGATATGATGCGGT
CAACATGGTTCTCGCTCGTCAGTTTTACAACGGTTGGTTACGGAGATTTACGTCCTCGTACATCCCTGGGAAAATTGGTCGACATTATTGGAGTGATATT
CAGTTCATGTTATACTGCAATGCCCTTGACTCTCGTGGGTGGACAATTTTACGTTTGTTATGAACTCCACGCGCAAAAAGAGCGTCTGAAAAAGGTACGA
ACTTGTCGATCCAGACTAAAGCTACTCAATATTTTTAACTTCTATGTTACGCGAAATAGGAAAGTTTAAAAGTACAGATCGTTCCATGCGTCTCTGACAA
TGATAATTCTGCTGAAGTTGAGAGTGAAGCTAAAAAAGCCATTTCAAATGCAATTGAAACATCCACCACGTCTCTTTCAAGATCTAACTCCACTGTTTGT
CCCTTGAATAccgttcaagatgaagaagtcATCGCTACACAACGTAACACACGACTGActgaagaagaaattatTCAACAATTTTTCCTCATGCAGAAAG
TTTTTCACGAAATGATTGATGACATCAGTATTTTAATTCAGCTAAGGAATGAGCAATTCAACTTGATAAAGAAACAAGCCAGTGACGATTTGACACTGTC
GAGACAACGAGAAGAAGTGATAAAGACCAAGATATTAGTCAATCTAGACTTTTGTTTGGTAAGTAAGTCAATCGTTTTTAAAGAAAAAGTTACTGACTTT
AACGGATGTCAGGCGGCATGTTTGAATTTTTCAGCCATGATTGAACGCTGCTATGGGTCGAAGAGAGCACCAAAGCCATTGCCATCAATCGCTCATCATA
CCAATGCATTGCTGGCCGCAGCAGATGTTTCAAATAAGTTGTTACAGGCCAATACAGACGCAACACTTAAGCCAAGTCAGAGCAGAAGGAGTTTAAGTTG
GAAAAATTCAAGCGCAGATCTGGCGATGCCTCGTCTTCAGCCAAAGCGGACATTAAAAAAGATTGCCACGTTGTCTAAAGTGCTAGCTGTGCAATACAGA
TCATCAGGAAATATTACAGATTTGGAGGATATTACCGACCCCCAGAACGAAGTGCGACCTGAATGA