Transcript Name :
Plaha_PHALS_05926
Orientation:
(+)
Number of Exons:
1
Description :
tkl protein kinase
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain27.086PS50011
HmmSmart predictionP-Valprediction_id
Leucine-rich repeat, typical subtype220SM00369
Leucine-rich repeat, typical subtype0.046SM00369
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Leucine-rich repeat, typical subtypeIPR003591
Y-scoreD-scoreY-pos
0.5160.69324
InsideOutsideTMhelix
385-716
1-361
362-384
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        2408 bases(100 bases per row)
ATGTGCACGCGGTTGGTTCATGCGCTTGTTTACTTGTGTATTATAGCGATCTCTGCCAGTTCTTCAGGCTCTAACAACTCACCTGCAAGTGGCATTCTTA
ATACGCTGACCACGAGCTGCAATGGTGGCTGCAGAAGCAATGGCGCCTGTGTAATCGTGGGCCAATCCGGATACAATTTCGTCAACTGCGTAAACGACAT
TAACTGCATCACGTTGTCGTCTGGTCAATCTGCGCTTTGCCTCAATGCTTTCAGTTCGATGAAAACTGAGTGGGTCTTTCAGCCCGGTGAGAGCAATGAC
ACAGCAGGAGTCGGACCCTTTGAACGTGTTGGATTGCTGCAGCTCGACGGCAATGTGACAGAGTTAACATTCAAGAAGgcagaagaagaacaaaGACCGC
TCTTTGGATCTCTAGAACTCGCTTCTATGAACATACAACCAGATGCTACACTGGATAAAGTGGcgtttcaaaatttgagtCTGTCTGGACTAGACGACGT
AATGCCTCTAAACAGGGTTAAACGAATGTAAGCGGCTCTTAAGCAAGTGAGACGAAATGAGGATTAACATGACCACTTGGCGTGTAATAGATATTTTAAC
AACTGCTCACTACGTGCAATTCCTGCAGTCGCTGTAGCTGGTGATTCTGTCACGGTCATGTAAGATATCGCTTTGGCGCAAGTATTTGCGATTTGATGTG
TCTCACTGAATTTGTTGTTCTACTGTTCTAGTGATCTAGCTGGCAATGCCATCAACACTGTGGACACAAAGTTTCAAAATCGGAATTCAACTAATCTTAC
TATGCTGTGCGTTAACACTGCGCACTTATTTTCTTGCTGTGGCTAAAATCAAATTCATTTCGTTTCGTAGTGATTTATCCTCCAACGCGCTTACAAACTT
TAATCTTGTCGCGAATAACTTTCCAGCCCTTACGAGTTTGTAAGTTTTTTTGTGCTGTATGCTTGGTCATGCCCCTTACTTAGCTAAGAGTATTCAGATA
TCTGCACGGTAACTTATTACAGGCAATTCCCAATGTGATTTTTGGTCTATCGACACTCCAGGAATTAACACTAAGTGACAATCCCATAAACGCATCGGGT
CTTACAACGCAGCAACTGACATTTCTATCAAATTTGCGCAATTTCACGATCGACGGTTTGACCAACACAAGTGAATGTCCAACAGCTGCAGTGCAACATG
CGTTGAAGactttttttgtattttgcGTGGGGGTTGCTGAGGCTGTTCCATTCAACAACAGTATACTCACCGAACAGCCACTGACAAGTGCGCCTGTGGT
GACCGAGAGTAAAgcatcatcttcttcatcacacAATACTTGGATTATACTTGGTGCGTGTCTTGGGGCTCTATTGCTTCTGTTCCTTTTGGGTATCATC
TGGTGGTGCTATCGCCGTCGAAGGGATGAACAGCCGAAGCTTATGAATAGTATGACACCAACGATTGGTATTGGAATGGGCGACTTGTCTGAACATCCAT
ACATGGGACTAGGAGCTCCCTTTTCCAATGTTTCGAGTCAAACATCGGCAGACTTCGAGTTGCTTGCCTCTGTGGCAGACGGCTATATTGGACTTACTCG
ACTTTCTTACGACGATGTATTTCTCCACAAGATGCTGCGGGTAAGTAGCCGTAGTGAGTTGTGGCTAGGCGAATACAAGCAAAGAAGTGTGATCGTtaaa
aagatcaaaagtAACACCGCATCAAAAGCATTACTCCGGGCCTTTGTGACTGAAATTGAGCTGATGTTTGAGCTCAAACACCCTAATATCGCGGTTTTCA
GAGGCGCTATGTGGGATGCAGATGGTACAGAGCTCTGCGCAGTGGTTGAGTTTGCCGAAAATGGTGCTTTGCGAGACTGCACTGTGCATAATGAGATCAA
TTTTTCCGTTTCGAAAAAGTACGATATTGCCCGGCAGGCCTCAGCAGCAGTGGCGTTCTTGCACAAACAAAATATCGTTCATGGTCGCTTGAGTGCGTTT
AATATTCTGTTGGACAAGAACTATTCTGTTAAGTTGAGTCTCTTCAGCATCTTTCACTATGTGAAGCTTTCACCTCTAGACAACGAGTGCAGGATTTTCG
TGGCTCCGGAAATTTTGCGAGGCGAGCAGCCGTCAGAAAGGTCAGATGTTTATTCCTTTGGTATAGCTCTTGTAGAAATCGACACCGGGGAAACTCCAGT
GATGGACGCTCGAAGGCTGTTGATGGATCGATCGAATTGCGATGTCAACGTGTCCTACACAGCAATGAAGATAGGGTACCGCTTGAGTAATCTTTGTTCT
GAAGTGATGAAGAAAGTCATCATTGCTTGCCTGGAGAAAGACCCTGTACGACGGCCGTCGATGGATGAGGTGGTATTGACTTTAAAAAATGCAGCGATAA
AGCTGTAA