Transcript Name :
Plaha_PHALS_01050
Orientation:
(+)
Number of Exons:
1
Description :
CRN-like protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-156
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        471 bases(100 bases per row)
ATGGTGACGCTTTTCTGCGCGGTTGTCGGTGAGAACGGAAATGCATTCCCTGTGGATATCGACACTAGAAAGTCGGTGGGTGACTTGAAAAAAGCCATTA
AAGAAGAGCAGATGTTTGATTTTGCTGCCAGCAAATTAGAGCTATATCTTGCGAAAAAGGGCGAATCGTGGCTGACTGAAAAGCAGGTGGCCGAAGGAAT
CTATGACACGAGCGATTTCAAGCCATTGAAGGTTGTGGCAGCCTCGCTCCATTTGGTCGGTTTGTCGGAGAAAGATGTTGCGTTTAAAGTTACGATGGAA
GATGTCAAGACGATGAGCTTTCCTGTTAATGTCGTAGTGGTTGTTCCGATCGGAATGAAAAATACACTGGCTGCAAATCGAAGAGCCGCATTATCAATAG
CAATCTCAGCAGCTGAACCGACGGAAATCTTCGTCACAATTGAAGAAATCCGAGATTCAGAGAAAGATTAG