Transcript Name :
Albla_Nc14011420
Orientation:
(-)
Number of Exons:
3
Description :
nucleolar protein putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-893
*** None ***
PositionContextScore
128ERKRKLR|DA0.525
577QECRMKR|SW0.751
TypeScore
nuclear913
GO
*** None ***
*** None ***
Cluster Id
1870
Sequence
        2804 bases(100 bases per row)
ATGCCAAAGCGAAAGCGAGTAGTTTTTCGGAATGCAAATGTGGAAACAAGGAAGAAAGTTGACAGAACGGGATCCAAAAATACAAAAAGCATTGCATCTG
CTTCCTCCATATCCACTACCAGCAATCCATTTGATCGACAAGGTAACGCAAGAAAGCAAAAATATCCGGTCCTTGGTCGCAAAGTAAAAGGACAGAATCG
AAACGTTGCGAATGCACGCTCCAAAGCCGAAACAAAGCGAAAGAACACACTTGCAAAACAATATCAAGGTCGTACGAAGGGCAATGATTTCGAAGATCGT
CGAATTGGTGAGCAAGATGAGTCATTATCATTGGAGGAAAAGATGATGGCTCGATTTCGAGCGGAACGGAAGCGTAAATTACGAGATGCATATCGATACA
ATTTGCAAGAGTCTGATGACGAAGAGGATGAGTTATTTCTGACACACAAAAATACCAAACTGGATGATGAGTATAATCGTCTGAATAATGATAATGATCA
GAATGGAGAAGATGGTGATGATCCAAAAGATGAAGAGATTCGACGAGTTGAGAAAGAAATTGTACAAAAGTATCATTTTGGTGGAGGAAATGTGGATGAA
GAGAAAGATGACAATAAGCCAAAATCGCATCAAGAAATTATGAAAGAAGTTATGCTAAAGGCGAAGATGTTTAAAGCGGAACGTCAACGTAACAAACAGA
TCCAAGAAGATGTGACGGAAGAATTGGATGGAGGATTTGACTCGATTCGTTCATTGCTAAAGTATCGTCCGAATAAAAACACTCCTCAGATGGACGATTT
TCCTTCTGCTAAAAAGGCGGAATTGGATGATTTTGATGTTATGGCACGTGAGTTTGCCTTTGAAGCAAAGGCACAAGCTACAGAACGCAAATTAAAACCA
GAAGAAATCGCACAGGTGGAAAAGGATCGTCTTGAAACGCTTGAGCGAAAGCGACTCGCACGAATGAAAGGGACTGACAGTGATGATGATGGTCATTCGC
GCAAGGACAAGAAGAAGAAACCGCCGATGAGTGTTCGCCCGTCGACTGATGATGACTTGGGAGATAATTATGAAATGAAACGAATATTCGGGACTGTGGA
CGGGGGAGATGAGGCAGAAATCGATACGGATCATGATCCAACAGAATTAGAGTCGGATAATGAAGAGCCAGAACAAGAGAGGTCGGAAAGCGAAGTGTCA
GATGAATCGGATGGTGCAGAGTCAGTGGAAAGCGAAGAGGGTGAAGATTCCGATGGTGATGAGATGAAACATGAAACAGAGTTGGATTCGATTGAGTCTT
TGGTAGAAGAAAAGCAATCGATTCGGGCGAGTGCGCAAGCTGCGACTGAGCTACCGTATGTTTTTGATTGTCCGCAAACACTCGCAGAATTGCAAAACCT
ATTTACCAAATATACGGATGAACAAGATGTCGAACAGAAAGTCCGCACACAGTCGCAGATTCTCGAGCGGCTCCTGCAGTATCACTCACCAAAACTCAGT
GTTGCCAATCAGAAAAAGATAAAGACATTGATGAGTGTATTGCTTCAATTATTGCTCGTGTATGGTCGCCAGTATACACGACAAAGAGAAAGTGTGAGTA
TACTGCAATCTTTTGTGACCATACGTGTGCTAACCGTATTCTTATTGGATCATAGATGGATGTGATATGTAAACACTTATGTATCCTAGCGCAAGAGCTA
CCCCAAAACGCTGGTTCACTCTTTCGCGAATTCGTATCCAAAGTGTACCGACAAAGGTTACGTGGAGGAAGCCAAGAATGCAGAATGAAGCGGTCGTGGC
CGGCCACAGGTGAAATTCTGGTGTTTAGGCTGATGACACATGTGTTCTCGATTTCCGATCTGCGTCATAATGTCATTTCACCTCTGGAGACTCTGATCGC
GGAATGTTTGAGTACTCTGAGACTACAGTCCGGTGATGACGTTACACAAGCTTTAGCGATGTGCGCCATCTCTCTAGAAATTACAAAAACAAAGAAACGA
TTTTGCCCTGAAGGTGCGTAAATTGCTTCCATCCCACATTCGTGTTACACACTGAAATTTTGCTTGTATACAGTGATCCAGTGTTTCCAGCGTATACTTG
GATTATATATTTGCCCAAAACACAGAAGAAGCCAATTTAGCGATGGTTTGAAAGAATGGGCTGCGACGAATCCATCTTCACTACCAACATTATCAATAGC
AGATAGCAATATTACTGAACTGGCACCTGCTATTCTCGGAACCACCACTCGTCTGATCCAATTGGCAACACAACAATACGAACACATTGCCTCCATCGAT
ACGCTCATGTATCCTGTATACCTTCAGTTACATTTGATATCAAATATGTTACCAAAGCCGATATCCGATATGAACACCGTTTTGGTAACACTGACCAAGG
TTACGCTCGAATGCTGGAAATTACGACGTCCCTTACGACTGCAACAAGCAGCGCCCTCTATTTTGCCCACTTTTACACCAAAGTATGACGCGAATTACGC
GATTCGTAAGGATAAGACTTTGGATCGCGATAAGGCAAAAGTGAAACAATTACAGAGACAAGTGAAACGAGCGAGAAAAGGAGCTGCACGTGAATTACGT
CGTGATGCTGAATTTCTGGCTCGTGAGAAACAGCAGGAAGAAGAGTCTCGACTCGGAGTGAAACGCGAGAAACAGAAAGAAATTCGCTCGTGGATGGAGG
AACAGAATGCCACATTTAACCAGCAGGTACGCAAAGGAGGACACATGTTGAAGGGTGGAGGAAGTATGCAAGTAAACAAAACGAAGAAACGATCGGCAAA
GTAG