Transcript Name :
Plaha_PHALS_11811
Orientation:
(-)
Number of Exons:
1
Description :
haloacid dehalogenaselike hydrolase family protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Cation-transporting P-type ATPase8.16PR00119
Cation-transporting P-type ATPase8.16PR00119
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-105
158-344
420-1010
1063-1092
1151-1156
1219-1488
129-137
368-396
1031-1039
1116-1127
1180-1198
106-128
138-157
345-367
397-419
1011-1030
1040-1062
1093-1115
1128-1150
1157-1179
1199-1218
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
integral component of membraneGO:0016021IEA
cation transportGO:0006812IEA
*** None ***
Cluster Id
12
Sequence
        4467 bases(100 bases per row)
ATGGCGTCTCCGCCAGCCCCTAGTGGCTCTCCCACAACGTCCTATTCGCTATTAAAGCAACCATCACCTCCAAAGGATGAGAAAAACATCGACAATGTCC
TAGGTAGCGATATTGTGGACGTTGTTGTTGATGAGGTGGACAGCCCGACAGGACTAAGTCAAGTTCAAGAGGATTATTTTAACAACGAGAAGCCACCAGA
TGATCCAAATTATCGCTATGTACATGTGAATGCTCCTGAATTGAACGCAGCACGTAATTATTGTTCGAATCTCGTGATTACCAGTCGCTTTACACCATAC
AATTTCTTACCAAAGCTTCTCTTTTACGAGTTTAGCAAGCTCGCAAATGCCTATTTTCTCATTATATCCATCATGCAAACCATCAAACCAATTTCGAATA
CTGGAGGATTTCCGGCATCATTACCTGCGTTGTCTATTATTGTTCTCATTGACATGTTTTTCGCGTGTCTTGAAGATTATAAACGCCATCAAGCTGACCA
TATTGCGAATAACTTGCCTTGTCACAAGTTTCAACAATCAACTAAAGCATTTGAACCGGCGAAATGGCATACTCTTCAAGTAGGTGATGTGGTCAAAGTG
TTTAATCGTGACCCAGTTCCTGCGGATTTGGTCATTTTAGGCGCGTGTGAACCTGATCCATTAAACCCAACGGGAATTTGTTACGTGGAAACAAAATCGC
TTGATGGCGAGACAAATTTGAAGTTGCGTCAAGGACTTGAAGCAACGTATACAAGACTTCGAACTGATGCAGCTGTTGGTGATTTAATGGGTACAATCAT
TTGTGAAACTCCAAATAATTCAATCCATCGATTCTGTGGCTCTTTAACGCTTGAAGATGGAAAAAAGGAAGTGATTACAACGAATGCAATTGTATTACGA
GGTTCGACTTTACGAAATACCGAATATATCTATGGAATTGTCGTGAATACGGGACCAGATACGAAAATTATGATGGCATCATCCTCAGATCCAATGAAAT
GGAGTAATATGGAACGACGATTGAATAAGCAGATTCTATACATTTGTGTTTTAATGGTCGCCTTGTGTCTCACAGGTGCAATTCTCTCGACACTTTGGAA
CGCCCATAATCTTGATAAAGATCGTGACGATGCTGCTTGGTATTTGTATGATGGCAACTCAACGGCTGTGAAGTCACCATTGAGTAATTTTTTCATTATG
GTCCTGTATTACTTTTTACTCTTAAATTCATTCATTCCTGTATCTCTTTACGTGAGTATGACGTCGGTGAAGTTTATGCAATCGCTCTTTATGAATAATG
ACTTGGAAATGTATCATCACGAAACGGATACCCCTTGTCAAGTTCGTACCATGTCTTTGAATGAAGAATTGGGTCAAATTGACTATATCTTTTCTGATAA
GACAGGGACATTGACGTGTAATATAATGGAATTTCGAAAATGTTCAATCAATGGAATTGCTTATGGTCATGGGGAGACTGAAGTTGGTATTGCTGCAAGA
AATCGTCAAGAAGCAGAAACATCCGTTATCTCTGTTACTCCATTTAGTGTCAAGAAAGAGTATGGGGATATTGTACCTGATGCGACTTTAGTACCCACAG
ATCGAGTGGTCCAAGTGCCATTTGTGAATTATCAAGATGACGCACTTTTTGAAGCTATGGCACAGAAAAATAGTGCACAGGCCAAAGCTATTGGTGCCTT
CTTTGAACACTTGGCTGTGTGCCATACAGTGATGCCAGAAAAAGCGGCCGACAATAGTTTGCGCTTGAGTGCATCGTCACCTGATGAACAAGCGCTAGTG
GCTGCTGCTGCATGTTTTGGGTACAAATTTGTAGCACGTGGACCAGGGAAAGCCATGGTTGAGTATTTTTCGTGTGTGGACAATCCGGATGCAATGTTTT
GTCATCAACCTGTTTTAGAACATGCGGTCGGACAGTACGAAGTATTAGAAGTGCTCGAGTTTAATAGTACGCGCAAGCGCATGTCGGTGATTGTGAAAGG
ACCAAGTGGTGAGTTGACACTGTTTTGTAAGGGTGCAGATACGGTCATGTACGAACGTCTGCGTCCAACAACTGATCCAATTGTGAATCAAACACGAGAT
TTGACATTGCAACATATGGAACAGTTTGCGTCCGAAGGTCTGCGTACACTTGTGATTGGAATGACTGACATTGACCCTGAGTTTTTTGATGCGTGGGTTC
TTCGCTATCGTACAGCAATTAATGACATGCGTCAAATTGATTTACGTCGAAATGGATTGGACAATGATATTGATCGATTAATGAACGAGATTGAGACGAA
TCTTGATATTCTAGGAGCAACTGCGATTGAAGATCGACTACAAGCGGAGGTACCAGATACAATTTATAAGCTTCGACAGGCTGCGATTAAAATTTGGATG
CTTACAGGAGATAAAGAGGAAACGGCCATAAATATTGGCTTTGCATGTCGATTATTAGCTACGGACATTGAACGGATTGTTATCTCTGCTGATACACATC
CAGATTTGACAAAAATTATGGATGAATTACAGGCACATGTACGAGATGAGCATGACGAAGTGGGTGATGGAAGTCCTGCTGTGAGTGCCTTGGACACACG
TACTTCTGTTTTGACTAGAGATCAGCGCAAACGACGCACGCGCATTGAAAGTCTTGCGGAAATGCCAGAGCAAGAATTAGCTTTGGTGATTGATGGTGAA
ACGCTTGAAGTGGCATTAGAAGAGTGTCCAGAGCTACTGCTGAAAGTCGCAGAAAAGTGTGTGGCTGTAATAGCATGTCGTGTTTCGCCAGCTCAGAAGG
CACAATTGGTTCGACTGGTACGGGACAATAAACCCGAAATTCGTACACTAGCGATTGGTGATGGAGCGAACGATGTGTCAATGATTCAAGCTGCTCATGT
GGGTGTTGGGATttcagggcaagaaggaatgcAAGCGGCAAATTCGTCGGATTATGCCATTGCCCAGTTTCGTTTCTTGTCGCGCTTGCTGTTAGTACAC
GGACGATGGAATTATGTTCGCATGGGAAAGTTGATTCTCTACATATTCTACAAAAATGTTATTCTTAATCTGACGCAATTTTGGTACATGATCTACACGG
GCTACTCTGGTCAAAAGTTCTTTCTTGAGTGGGGACTTCAAGGGTACAATCTTCTCTTTACAGCATTACCGATCATTCTTGTCAGCACGTTTGAACAGGA
TGTGCCTGCGTGTCTTGCACATAATTATCCCTTGTTATAtcgtatcggacaggagaaTACACGCTTTAATACGAAAGTTGTGTGGGCGTGGATTACGTCG
TGTGTCTGGGAGTCACTCATTATCTGTTTTGGTGTCGTTTATGGTATGCGGTACTTGGTGACAAAGGCCGATACACCGACCATGTGGGTTTACGGAAGTA
CGTCGTTTACAATCGTCTTGATTGTCGTCACACTTAAACTCTGTTTACATCAACAAATGTGGTGGCCTATTCATATTGTAATTTACATTTCTTCCTTTAT
GCtttggatcggtaccgctgCGTTAATCTCGTATGGTGACTCAATCAGCTCATCGTACTGGAACGGTGTCTTTACCAACACATTCCGCGTGGACGCATTC
TGGTTGGTTGTTCCACTTTTGGTTGTCGCTGCACTCTCGCGTGATTTTATGTGGAAAGGATACATGCGTATGTTCCGACCGTCGTACAAACACTTAGCAC
AGGAAGTGAACGCGTTTGGACTCACGCACATTGCTGATCAATTACTTACGTTCCCACCTGCTCAGAAGATTCCAGAGACTGCACTTGGAAGTGAAGCTGG
TCGTGCTGCCGTCGTATCTGCTGGGACAACAAGTATGCGAGATTCAAGTGTGTCCAAGCCTGTAGTGCCGACTGTTGTGATGACGTCTCGACCGTTGAAT
AGCCGGATCGGCAATCGTCGGTCGGTCACACGCGGCAGTGCGTTCAGCTACGATGCTGAAAGTGTCATGGTCGAGTCGTTCATGGCGACAGATCGATATG
CCCGTGACGCAAAGCGGACCAAATCGATCTTTGACCGACATGCGAGTCGCGGTTCGCTAGCGTTTCATAATCTCCCAGCTCAACCAGACGGAGAAAATGA
GACTACACATCCACGGACTGGCATGGTAGATGACTCGCTATCCCGCTCCGCTGGCAATGTATTCCGTGGTGCTCGTCATGGTCACGGCCGTCGACGTTTT
TTGTCCGTGACTGAAAGTTCACGTGGTCGTGTAGACGCACCCACCAGTTTGTCTGTGACCACGCTGGACCGTGTGCGCGAAAATGCGACGAATAATTTTG
GACACCGTAGTTTCCATCGACCGTCTGTCACGCAACGAAGACGTGGGTTCGAGAATCGTGCCTTGTCAAGTGACGACGCGCACACCCTTGCACGTCTAGA
CAGCGGCAATTTATCTGTGCGGCGCAATTTACGGCGTAGTATGAAGAATGGGAACGACTGTGTTTAG