Transcript Name :
Plaha_PHALS_08586
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_325501
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-366
NN-scoreoddsWeighted Score
0.8294.5180.009
*** None ***
TypeScore
nuclear478
GO
*** None ***
*** None ***
*** None ***
Sequence
        1177 bases(100 bases per row)
ATGAACGCAACTTCGGAAGCCACCGAATCGATGATGACGGAAGGACAGAAGTCAATTTACCTGTTCCATGCGTTACCCAAGTCATGGAAAGATGATCTCC
GTGTTTGGAAGGGTCAACGGAAGTATATCCCGTATGGAGAACTAAAGGCCAACATCGAACGGAAGGTCCGCGAGATCCGCGCTGAAGAGCGCTACACACG
AGCCAAGGGAACGCCCGAGAGTCAAACGACGAAGAACGAGCGGGCTCTTGTTGCTCAGCCCAACTTGACTCAGTCTAGTGGAGCTAATGTGTGCACATAC
TGTGAGCGTCCGCGCCACAACATTCGCCACTGTCGCTCTCTGCAAAAGGATCTACGCGAAGGCCATGTGAAAGCTGGCACGGTACTTCCCGCGAATTTCA
TGTTTAGGGGAGGCAACTTGAGCCACAACCACCCGTACCGCCAAAACAACAAGCGATCTAATCGTGGCCAAAGCAACCGTGGTGGACGCAACAACCGTGG
GTACCGTGGTGATTGTGATCGACGTGACAACCGATCTGACAAGGGCCGAGCCAAAGACAATTCTGGCGACAAGCGCAAGGAATTCACCCAAGAGCGTCGT
GATGTCGGGCTTATTGCTGTTGTAGCAACTGTGCATCCTGTGATCAGCCTGACTGCCCAAGCCACTGCCAGCCCCGAACCCACCtggacaatcgactctg
gatGTACGCGTCACGTTACGCACGAATCCCAGTGGTTCTCGACCATATCCGCGAGCAACGGTTCAATCACCGTTGGTGTGAAGAACCAAATCCCCATCGA
AGGAATTGGCAAAATTGAGCTGGAAGTCACTGACTCCAAAGGCACGCAGAGGATGCTTACCCTCCACGATGTGCTGTACGCTCCTGAGCTGAAATTCAGC
CTTCTCTCGGTACCGGCGGCTGTGAAACATGATTTTCGCTTCAGCTTTGATCGCAAGCAATGCGCCGTGCATACCGAGCCGAAGTTCAAGATCAACGCAA
TGATGGCAACCCATGCGGATCTGTACCAATTCCAGGCCAAACCTGTGATGAAACATGAGGCTCTAATCGCCACCTCAGGTAAGCAACGATCCAATCTGCT
TTTACACAAACGACTCGGTCATCCTAACGTACGCATTTTGCACGATTTATCTAGGAGCCAAGCCATTAGTGGTCTAG