Transcript Name :
Plaha_PHALS_12049
Orientation:
(-)
Number of Exons:
1
Description :
Gamma-tubulin complex%2C DGRIP91/SPC98 component
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1162
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
1186
Sequence
        3946 bases(100 bases per row)
ATGGTAGTTCCTCTTCGCAGAAAACGCATTGAGCAGCACGTTGCGCTCAATGCACAGCTCGCGGACATTGAGCAGCGTCTGCAGGAGCTATATAAGTCGT
CTTTTGACTTTGCTGTGGTACCGGGATCCTCCGAAAAGGAAGCTGTGCAGCGATCATTACGCTCTCTTCGGCAACTCACGCCTGAAGTAACTGTACTCTG
TGCGCAGACTGGCNNNNNNNNNNGCGAGTGGCGGCCGCTCGCCAGGCAACTGTGTGCTCACATCATCACCGACGATGCGACAAATGAAGCAGAGCAGTCT
TTGTTTCACAGGGAGACGCTGTTTTTACGAGCTGATCGTGTTGTCGGGCAGCTTTACTCGCACCGATTCGTGGATTCCGTGCCTCAGGATGTTCAGGCTC
AAACTCAGGCGCTTGCTCAAAAGTTTCGCGTTCATTCACTTGAAGATCGAGCTGAAAAACTGCTTGAGTTATCGATTAAATGTGACTACCAAGTGCTCAA
GCTTTTATTGGAGTTGGCTAAAAGTCCAACGACAGCCACGGACCAAGAGGTGGCGGTAGATTTAAACACTGAAAGCAAGTGGAAAACTATAATACAAAAA
CAACAGCATGAACTTGAAAAGCACAAGTTACTGCAGGAGCAGCTGGTTGAAGAGTTGTTTCAAATTTCGACAAATGACGAGTGGTTTCAGGAGTGGGAAG
ATAGTGACGAGGAAAGTAGCGACTGGGACATAGGTAGCTTAGATGAAAACGCCGCGAAGACTAATTGCGATGTAGAATCTTCTCATCGTAAATTGATGAG
TTCGAATGAAACGCTCAATAACGAGTTGGACAAGAACCAGAAACAAACGGACAGTGTGCTGGAATGCGATTTTGAGCaaactgcaccacaggagaTAAAC
ACAAGTGAATTGCTGGAATTATCAGACGATGAAGTAATACAGAATGATCTCATCCGTCGTTATTATCAAAAAATTACTCCTACTGGTGATGATATGGAGG
CTGACGTTGAGGACCCGACAATATTATTGGATAAAGAAAGCTTGACTCCTTTTACGTTAAAGCGGCCCTGGTTATTGTGTGAAGCGGTGGTCAAAAGTGC
AGAGGCTACAACAGCGATCAAGGATATCGTTTCAAGTCGGCTGATCCACGAGTCAACTGTGGTAAATATGGTTTTCGAGGCATTGCATGGAATTGAGTCA
CTTTTATTTGATTTCTATCCTGTCAATCCCATGCCCTCAGTCTTTAGTACTGATTTCCGAACAAAATATGTAAGGAGAACTCAACACTCTCAAAACGTGG
CGATGGGACATATCTCTCCTTTAACATTTCATAATGTTATAGATCATTTCGCAGAAGCAGCATCCGAGCTGCAAATGCTTCGAGATTTTATTCATTTTGT
TCACGGGAGATGTGATCTTAACGAGCAACTTCGTTGTGTAACATTTGAGGGCTTAGCAGATGCTCTGTCTGAAATTCTCAAACGTATCGTGGACTCGATA
ATCTACGTAGAGCAACAGGCCAATACATTAGGCATGAAGGATTCTCGGCCGTGGACCGGAATTCACTCACGTCAACCCACTTTGATTGGTCTACTTGGTG
gcttgaaaaaaatctttgcgATGGTCTCGTGGCTAAATGGAATTTTAAAGGAGTGTTTTCATGCCTTGTCACATCAAAAGTGGCATGAAATTAAACGTGC
ACAACAAGCAAAGTGTGTGCTCGATTCATTGTATCGCCTTATGGAGCTAGAATTTGTAGAGGGAATGGGAATTGACGAAGTTGTAAGACCCGCACAGTAT
TTATCACGATCCAATGTGCTGTTGCATCTTTTTATTGGTGCGTTGATGCCATACCTAGGCTTACTCAATCGAATGGTATTCAATCGAGGGTTTTTTGAGA
CGATTCCATTAGAGAGTGAGTTGTTTTTCGTAAGATTTGTCTCAATAAATCGGTGTGATCCTTCCTGGCGCGAACGAAATCAAAATTTCCGTGAACGTCT
GATGTTGCTGGCGCCTTTCGAGATAAAAGGATCTCTAATGCCAGCATTTTTAGAATCCATGAGTTCGTTGTTCATCGAGGCACTTGCCAGTCGACAGCTG
CAAAATCAATTCTTACAACAACAacatacatcaaatgaatccTTGACAAATCTAAAGCTGACCGGACCCTCATTGCAAGATATGTTTTTAAGTGAGCTTG
AAAAAAGAGGGTGCAAACGAATATGCGGCATCTTTTCGGTCGTGTCTACGAAAGTGCGCAGCCCTGAAGGAGATATGTTATCTTTGCCGCAAACAATGCT
TGATTGCGTACCTTTTAGCAATATCCTGAAGCAATGTTTAACGCAACATATTGAGCACAAGGTAACATTTATCCTTTTTTTATGAATATTTAATGATCAT
CTGAACGCATGCTCAACTGCAATAATAGTGTCACGAACTTAATGGTGAGATCACAGACATCTTTCGAGACAAAATGAATTATATGGAACATGTCGAAACT
CTGCGATTGTGTGTTCTTATGGAACAGGTAAATGCTTGGTATACACGCTGGCAAAATCTTGAATGAACTGACTAATGGTTTATGTTATATAGCAAGACGT
GCTCGGCAGTTTTTGTGATAAGTTATTTGATCACATGCAAAGAAATCCCGTTGCTTTGGCAGACATTGAAAAAATCAATGCTTTTTACCAGGGTGTGCTT
CAAGGAGTTTTCGAGAATAATTCGTTGTCATCTACGCAGAGAACCATTGGGGGTCACTTGTATTTACGGGTCAATCTCAATCAAGTGGAAAGCATTTTTT
CAAGCGGCACCAACATCGACATCGCGACAATGAAATGTCTATATTTCACATTTGCTCTTTCAGATCCACTAAGAGTACTATTTAGCGCATCAATCATGCA
GAAGTACTCACAGCTCGGGATCTTATTACTGCAAGTAAAGTCTGTGGAGTCAGCTCTGATTAAggtaaaaaattaaattattATCATTCTTCATTCGACT
AAATCGTGGTGAAATGTATTGTTCTATAGTTTAAGTCCACCATTCGCCATCACCGAAGCTACTTCATGTGCGAAGATGCCTCCCTTTACTTAAAAGGCTG
CAGTGATTCTGATTTTTGACTATTCGCTTGTAGAATAGAAAACGAGTTGCGGCAAGCCCTGCTTCAAATTGCTGATATGCTTCACTATACGAAGACTTTG
CTAAATTATCTTTTAAGTCAGGTAAGATATAGGTTGTGACCCATAAGCGTGTTTTTCTGTCTTTAACACTGAACCTGACAGATATCGAGTGAAAGATGGT
CCAAATGTCGCGATGAGCTGCAAGCCTCGCAAAGTCTAGCTGAGGTACAATGGATCATGCCTTGCTTATGTATGGTAACGATTTTGTGTGCTGACGTCTT
CGTTTTTTATATTTAAGATGGATGCCATTCATGAAAAGTATCTCGATCACCTGTTAAATcgcttttttcttcttgagaAGGTATAAGGTTGCTGTTGTGT
CCATTTCACATATAATCTGAtgctttttttacttttcttAGCATGCGACCGTAGTTCAGTACATCGTGACAACATTCAACAATATTCTGTGTTTTGTGGG
CCACGTTGAAAAGTTTGCTGGCGCAGTAGACCGAAACCTGCATCAGTATTTTCCCAGCATGTCATTTGAGACGAATCGCGATAAGGTGTCGAGTGTCCCG
TTGTTAGAGCACCCTGACTTTTGCATTCTTCGATCTGAAATGACTCAGAGTGCAAAGAATTATAAGCGCCAGTCACATTTTCTTGTGGTTATGTTGACCG
CCATGCAGAAGCACGGAGCATCTAAGCATGTGGAATTTATCTTGACACATCTAAACTTCAATTACTTTTACCATCATAAAGATGATCGATCGCGAATCCA
GCGCAAAGCACAGGACCAACATAAAGCTACGAATGCAAACTTTTGA