Transcript Name :
Plaha_PHALS_12048
Orientation:
(+)
Number of Exons:
1
Description :
pre-mrna-splicing factor atp-dependent rna
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain19.576PS51192
Helicase, C-terminal16.071PS51194
HmmSmart predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain8.9SM00487
Helicase, C-terminal4.5SM00490
Helicase-associated domain2.6SM00847
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Helicase, superfamily 1/2, ATP-binding domainIPR014001
*** None ***
InsideOutsideTMhelix
1-947
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
nucleic acid bindingGO:0003676IEA
helicase activityGO:0004386IEA
KO ID
K12813
Cluster Id
68
Sequence
        2844 bases(100 bases per row)
ATGCACGGAGACTCCGCGCGCAAGTCACGTCGCTCTGACGGGTTCTCCCGTCGTCGCCGACGCCCAAATGATGACGATAAATCCCACCATTCTCAAGATG
AATCCGACATTGAAGTTATTCCCGACTTTCGTTCAAAACAGAAAAAAGAGGCCGCGCAAGACGACACCGATCTGTCGCCTAGTGAGCGCGAACGACTTCG
TGATCGTGAAGAACGTGATGCCTTTGCTGAGCGCTTGCGACAGCGCGACGAAGCGCGTACCAAGAATAAGCGCAAGGCTGAGGAAATGGACGACCACAGA
GGACTTACAAGCGACGAAATTAAGCAGCTCGCTAAGCGTGGGACACTTGACGCTGCACAGAATGAAAAGGTGAAACAACTTAGAAATTTGAGCCGACAAG
AATATCTCAAAAagagagaagaaaaagaacttGAGCTGCTTGAATTTCAATTAAAAGATGAAGACGTGTTGTTTGAAGAGTCTAGAAGGTCTAAAAAGGA
GCAGCAGCAACTCGAGCTCAATAAGCGAATATTAGAGACAGCTAAGGCCAGATCTCAGAAAGAGGAGGTTGACGGGTATCAAATACCTGATTCATATGAA
GAGGTTGATGACGAGGGCAATCGAATAAGAAAGAAAGAAGACTTACTGACGGACAGATACGAGGAGGAGGAAGTGCTTCATACCGAGCAGGAGATCTGGG
AGGACACACAAGTTAAAATGGCTTCAAGTCGATTTGGAGCCAAAGATAAGCGCAAGGAGATACAAAAAGAAGACGAACTTATTTTTGATGATCAAATCGA
GTTCATTTCGCAGCAAATGCTATCCGGACATCATGTGAGCGATGAAAATGTAAAAGAAGCGAGGAAAAAAATGGAGCAGGCCAGGCATCTGAGTATTCAG
GAAGGAAGGAAGCAACTACCGGTGTTTCCGTACCGAGAATCTCTCCTTGAAGCAATTCGCAATTACCCGGTTATTATCATTGAAGGTGAGACAGGATCAG
GAAAAACAACTCAGATCCCTCAGTATCTTCATGAGGTTGGGTACTCGAAGCTTGGCATTATTGGCTGTACGCAACCGCGACGTGTTGCTGCAATGAGCGT
GGCAGCGCGTGTGGCGCAGGAGATGGATGTGAAACTGGGGAATGAAGTGGGATATTCAATTCGTTTCGAAGACTGCACTAGCGACAAGACTGTAATCAAG
TACATGACCGATGGTATGCTTTTACGTGAGTTTCTGACTGAGCCCGATCTCAAATCCTACAGTGTCATGATAATTGATGAGGCCCATGAACGTACACTGA
GTACCGACATTTTGTTTGGCTTGATTAAAGATATTGCTCGGTTTCGAGATGATATTAAGATCATTGTGGCGAGTGCGACACTGGATGCAACTAAGTTTAG
TGCGTACTTTGACGATGCTCCCATCTTCAAAATTCCTGGACGTATGTTTCCAGTAGATATTTTGTACACGAAAGCCCCTGAAGCGGACTACTTGGATGCT
GCTATTGTGACGGTGTTACAGATTCACATTACTCAACCACTTGGAGACATTCTCGTATTTCTTACGGGCCAAGAGGAGATTGAATCCGCAGAAGAAATTC
TGCTTCAGCGAACTCGCGGTCTCGGCTCTCGAATTCGCGAGCTACTTATTCGGCCAATCTACGCAACTCTGCCTTCAGAACGCCAGGCTCAGGTATTTGA
GCCAACGCCAGAGGGAGCTCGTAAGGTGGTCCTGAGTACAAACATTGCAGAGACGTCACTGACCATTGCTGGTATTTGTTATGTGATCGATACGGGCTTT
TGTAAGCAGACAAACTACAACGCACAGACCGGCATGGAGTCGCTACTGGTCGCACCAGTCTCCCAAGCCATGGCCAATCAACGCGCTGGTCGAGCAGGAC
GTACAGCTCCGGGCAAGTGCTTTCGCCTGTACACTGCCTGGTCATACAAGAACGAATTAGACGAGAATACTGTACCTGAAATTCAACGCACAAATCTTGC
CAGTGTCGTTTTACTCATGAAATCTCTAGGAATCAATGACTTGCTTCATTTCGACTTTATGGATCCTCCACCCGAGAAGGCGCTGATTCGCTCGCTTGAA
CAGCTTTACGCACTTGGTGCACTTAATGGCATGGGTGAATTGACAAAGTTGGGACGTCGCATGGCTGAATTTCCGCTTGATCCCATGATGTCCAAGGCAC
TGCTTGCTTCAGAAAAGTTTGGCTGTGTTGAAGAAGTCATGACAATCTGCGCCATGTTGAGTGTAAACAACTCAATATTTTACCGACCAAAAGACAAGGC
AGTTCATGCTGATAACGCTCGGCTGAATTTTGCGCGCGGTGGTGGAGGAGATCACATCACGCTAATGAATGTTTACAATCAATGGGTAGAGACAAACTAT
TCGACTCAATGGACATATGAAAATTTCGTGATTATGCGTTCACTAAAAACTGCTCGCGATGTTCGGGAACAACTTGAAGCTCTTTGTGATCGCGTCGAGC
TTGAACGCACAAGTAATCGCAGTGACCACGAACCGCTCCGAAAGGCAATTTGCGCCGGTTACTTTTACAATACAGCCAAGTTGGACAACTCGGGCCACTA
CAAGACCGTAAAGAAAGCACAGTCAGTGCACATACATCCAAGTTCGTGCCTCATTAAGCTTGAAGAAGTCCCGCGTTGGGTTATTTACCATGAATTGGCG
TTTACGACTAAAGAGTACATGCGTAATGTCATTCCAATCAAATCAGAGTGGTTGATGGAGCTTGCACCTCACTACTACAAGTCAAAAGAGGTTGAGGATG
CTCGCTCAAAGAAAATGCCAAAAGGTGTCGGTAGAGCAGGCTGA