Transcript Name :
Plaha_PHALS_12054
Orientation:
(-)
Number of Exons:
1
Description :
tkl protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain26.987PS50011
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-250
274-689
251-273
NN-scoreoddsWeighted Score
0.7553.0230.006
*** None ***
TypeScore
nuclear391
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        2070 bases(100 bases per row)
ATGATCTCTTGGTGTTGCACTGCCGCGAAGGAGCGGAAGACAAGCACAAAATGCTCCGCTCGCTGCGCTCTAGATGCTGCATCGTGTCTACAGAATGGAG
AATGCACATTTCCACTCGAGAAAACAGTCAAAGCCGATTGGCGTGTGGTGCTACAAGACGCGCCGATCTATTACTTTGATACCGTGGTACTCTTGCCGTG
GGTGGAGACATTGGAGATAATAGGAAACAAGACGCGCGTGGTATTTAATGACGTCCACCCTTGGACAGGCAAGCATCTGACTGCGGTCTCATTCGCTGGC
TTAGATTTTACCGATTCCCCGTTACCGCTTATGCCACACTCAGTTACCCACTTACAATTTGTAAACTGTGTCTTTAACCAATTTTCTATCGCGTGGATCA
TGTCCCTCTCGGAGCTTAAGTCGCTTGTGCTCAAAAACAATTCACTATCTGATGAGACACAGATACTGATGGAACTCAGTGAGCGACAATTTCAGGTGCT
GAGATCACGATTGTCAGACGGGAGTATTCATCAGGATGAAATAGATGAAGAAGGAATGTCAAAATGCACAGTCTTACGAGGCCGCATCCGAAGACTAGGT
GGCTTCAATGTGTGTATTATGCCTGATGAAGAAGCCACAGTGACTCGGCAATTGCAGACGCACGTGGACTCGGTATTTTTTAATAGTGAAGAAGATGACA
CAACTTTTCAAGAGGATGAAGTTAAGACTTCTGAGCAGGATACGCCGACTCTTGTGCTGATCAGTATGGCATTGCCATTCATCTACTTTCTGTATAAAGT
TGTTCTCTACATCTCGTTTGCGAGAGCGAGTCATCGCGATAGTAACAGTGACGTTTCACCCGTCACCAACTCAAAAGTTGTGGACATAAATGAACAAGAG
CGTTCTACGGCCAACGTATCGACCACTTCACCAACTGTCAGTCCAGTTCAACGTGCGcatcgaaaagaaaaaaaatcgttTTTTTTCGGTACTGAAAACG
CTGACTTTTGGGTGGACGAAGAATTGCAACAGTGGCGACTGAATTTTCATCGTCTAAAATTGCTTAAGTGGCTGAACGTACCGACTGATGAGAAGCGCCA
GACGTTGCGTAAACAAAGTGTGACGACTACCATAAATCCTCATGAAATTTGGCTGGCGTCTTTGGCATCAAATGAACAGGCGGTGGTAGGCTCATCAGAA
AAAACATTTGTGGTGGCAAAATTTCTGCCGCCCAAAGAAAATTCTGGTCGGCGATCTTCAACATGTGGCACGAGAGATAAACTGAAGAGCGAAGTTAAGC
GTCAAGCTCAACTAAATCACCCGCAAGTCGTGTCATTTATCGGCGTTGCCTGGTCGCGCGGAACGAACTTGGTCGCTATCACAGAATATATGACTCAAGG
TGATCTTCGACAGTGGCTTCGTCGAACTGCAGTCACTCACAGTGGCAAATGGACAGTTTCTAAAGTTCAAATGTTGCTAGATGTAAGTAGCGCGCTGCTT
TACATTCACTCTGTACTCCCCCATTCGGTGCATGGTAATTGCAATTCTCGGAACGTACTGCTGAATGATTCACTGCGTGCTAAATTGAGTGATTTTGGAA
TAGACAGTAGGTCTGATGGTTTCACGGATCAAGAGCTCACGTCGTACAGTATAGTGGGTTCCGGTCGCTGGATATCGCCTGAAGCTCTTTTAGGCCGTGA
GACTTGTGCGACGTATCCAGATGCAAGCGACGTTTACTCTTTTGGAATTCTCGTTGCTGAGGTAGATTCACATGAGTTGCCGTTCTCAGATTTATTGCAA
GCAAATCGGTCCGCTGTGCCCGAGTCGGACATTTTGCAACTTATTGCTAGAGGTGCCTTGTCGCCTACATTGTCGCCAGGGTGCCCCCAAAGTATCGTCA
AGCTCGTTAACGCATGTACGAGCTATAACCCCAAGCACAGACCTAGAAGCGCACAAATGCAACAGGATCTGCTTCGCATTCTGGATGAGATCCGAGCAAT
TAGTAATGATGCGACAGCTCCGATAGCAGGTGATGTCCCTTCACGCTCTCGTACAAGTGCAACAAAATAG