Transcript Name :
Plaha_PHALS_12055
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.7710.76726
InsideOutsideTMhelix
1-486
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3988 bases(100 bases per row)
ATGGATCATCTTTCTTCTTTTCAGGGTCTGGCCATTTTATTCGTGGCTTGCAGTTGCCCTCTAGCCACACTGGCTCGGGTATGAGAGACTGCAACGACCA
TTGGCTCACATTCTCTACCGGCCCTGGCACAAGATACACCAGCTTACAGATGCTCTCTACCGTCGCACAGATATACACTCTGACCACCGCGATATTGCAG
TCGCCTTTTTGTCTCATTCGGACCATTGCCGCTTTTGTCTTCCGAGCTTTGCTCAAGGAACCTAGCAATACTGGTGCTATCAATTTTGGAAAATACTGCT
CCccgccagtagtaatgcatattgattaggtaTTATTATATTAATGAGGAAAACTTATGGTCTAAgaaattggcggctctgccgcaatcaaaacaattaa
atacagtttcaatttaaaGGGAAGATTCCTTTCACCCTAGTTAAGGTTTTCAGTGCTCTTTGAGGTAGcgcattgcgatccgctacactcgtattggttc
ttgtgaagaacgcaAGGTCGGAGAACTAGTTTAacttcttctaagcaaagagtaaCGGCAGCCCCGATGCACTCCCCGTGATGGGTTCATCGGCCACTCT
TGTTTAAGAGGCCGATCCTTCGATTCGGGTGGCGTCGTCATGCAGAATATGTTCGACAATGAGTGGACACATGATCAATAAGTAGGTAAAGGTACCGTAT
TCCCCTAACGGAGTCATAACCTTAGCAGATATCAACGCGCCTGATGCGATGTCTAATTTGCATATTTGGACAATGTCTCTATCATGCTATCAGAAATTTG
TGCAGTGCTTGGAGATGATGTAATTGTAGATTCGTCATGCTTTCGACAAAGCCACCTATTTCTTAACAGGTCACCCCACTGGTGCCGAATGCTATGTCCG
AGCTCAACAGGCTACATAAGCCCAACAAGCCGAAGATTAGGCAAGGAGGCTACTCAAGGTATCATACCTTGGATCAAtgactgtaacggggttacatgag
agtgtcccgtcactctcccaagggggctgtggtgtggcatacaccacagctactagatgggtacatggcttgagagACATGTAATAGGAAAAACATTAag
aacacctataaatatattcagtcttaaaactacctaaatCTGGTTAACGTTCCTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTACCAAGAGAAGGATAAAGGCTACTCGAGCCGCTATGCTGATGATGATCGCGGTGTGTCATCAATTAGCAATTGTACAGTGTTTTCGTTGGACT
AACATGTGAATGATAAGGTAACGAAAGCGACGAATCGGAGTCGGAAGAGGAAGCGCGTTCAAAGCGACGAACGTCCTCGTCAAAACAAAATACagctgca
aagaaaaaagagGTATGATGTGTAATGGGTATTTTTTGTTTGGATAGGTGCTAAATTGTGATGTTATCAGGAGCCGGAACCAAAAACCAAGCCCGCAGCT
AGTATACCTTCTGCAGAGCCATCTCTTTTAGACAGTGACTTTTTTATCGCCGCTCCTGCTGTCGGTACGCTTTCGTCTTTGTGCTCGCTTAAACTACATT
TTTAGTGGTGACTTACGGTCACATACCTCTGCAGTCACTGTAACAAACACCTTCGATCCGTTCGCGCCAGCTCCTACTGGCCCTGCGGCGGCACCTCAAA
CAACAATGTTTGCCGCATTTGAAAATGCTGCTCATGCACCCCAGCCGCGTTTTGATGCGTTCGGCCTCGCACAGTCGCAACAGCCGCAACAGCATCAAAT
ACAACAGctacaacagcaacagcaacagcaaatgcAACTGaagcaacagcagcagcagcagcaacaacaccaacaacagcaacatcAACATCAACAGCAA
ATGCAACTgaagcaacagcagcaacagcaacaacaacaacaacaacaatctTCATTTACTACTTTCGGAAACGTCGCTACTCCTGCTCAAGGAAGTTTTC
AACCGTTTGCTGCTTTTTCTAATCCACCAGTTCAGAATAGTTACAATGCATTTGGGCAGCAAACTAACACTGTGCCCCCCCCACCGGCTGCATTTAATCA
ACAGCAGTTCGGACAACTTGGAAGTATGCAGGGTGGAATGCAGGGCGGTatgcaaagcacgatgcaGCAGCAGCCCATGCATAGTGGCATGATCATGCAA
GGTCGAACAGCTTCTAATTCTGGTACAAGTCAGCCGCCAACAATTGTGGAACAAAAGAAGAGTAATGATGCGTGGGGAGCTGGCTCTTCGCTGTTTAATC
TCAACAATCTAGGGAGTACCACCAGCACCAATTCTGGTAATGGCAGTCGTCTCGGCCAGCAGCAATCCATTGTAGGTCACAACAGCTTTAGCGGCTTAGA
CACTCTTGCTGGTATGCCAAGCAAATCTGTGATGGGAGGATCAGGTGGTGTGGACCCTATGGGTGGCATGAATTACGGCGGTAGCATGAATTACGGCGGT
GGCATGACCATGAATTCCCGTGGAATGCAGCAACAGTCTACTGGTCAGATGCCGGTGGGAGGCATGGGTATGGGTAGCATGCAGCCTCTACAAATGACGG
GAGGTATGGGCATGCATCAAGGAGTAGGAATGCAGCCAGGAATCGGTATGCAGCCAGGAATCGGTATGCAGCCAGGAATCGGTATGCAGCCAGGAATAGG
CATGATCAATCAGGGAAGTATCGGAGGTAtccagcaacagcaacagcgaCAGCAGCAGGCTTTTAACCAGTTTAGCAAATTTAGCTGA