Transcript Name :
Plaha_PHALS_12050
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.7020.74923
InsideOutsideTMhelix
1-680
NN-scoreoddsWeighted Score
0.5131.1070.002
*** None ***
TypeScore
nuclear391
GO
*** None ***
*** None ***
*** None ***
Sequence
        2043 bases(100 bases per row)
ATGTTCGTGCCGGTCCTTTCGACTTTATTACTGCTTGAGTTCAGTGTATCCTCCACGACTAATTCGAGTATTATTCATGATGAAGACCAAGTCGTGTTCG
TCGGGCACTTGAATGATTCGATGCTTTCTGCAAATACTACCCCGAGCGTTGCTAACGGGGAGTTAGAGAGGAGCAATGATAGTAAGCAAGTCATTGATGA
AACTATCGGGGAAGTACGGACTTTTCCTTTATTTGAAAAGTTCGCCAAATGGTTCGCTAAAGACACGCCCGTCGAATGCCGTGTAGAAACTGCTTCAAAC
CTAATGAAGATAAATCCCCGGAAAAGTAAGCAAGATAAAATAGTGTCACAGCAAGTTAAGAAGCTTTTCGAGTCAGATGATGGAGCATTGGCAttatttg
ccgaagtgaaagTTTCCAAGTTGCTAAAAGACGAAGTGACACGGGAATTAACGGAAGAATGGTTCACCAATTCTCATACCAAGTTATCAGCACTATTTTC
AACTTTGATGAAGGAGACAAAAGAAGGATCACTTGATGAATTTTTTCAACTTCAGCTACACGTTCCGCTATATAGGTACGCCTGGCGATTATATGAATAT
GTGCCGTTCGATTTGGATATAATCGCAACTGATGTCGCTCGACTCCTGACCGAAAATCGTAAAGGAGGTACTTTGATAACTTGGTTTGGAACTTATGCAA
CCCCATACTCAATTGATCTTTATCATCCCACTCTAACTGATAATGTACGTCTCGTAATTGGTTTGTCACGTCATCCGAAGACCCTCAAGCTAGCGTATCG
CTTACATGCATTGTATACTGGCGGCCTTGTGGATTTTCGTCATAATTATATTCCATCTCTCGCTCTTTCCGAAGAAGAGTTTTGGTTtaattttgctgct
tttgttCGTTTCAACTACATAGAGCATGAAGCAAGAAGCCTTAAGTTTATGTACTCTGAGGTCGCGCAATACTCGAAAAAGAAAGCCCTCAAGAGTTATT
TGAGTGCTGTATCGAAAGCAGGGAAATTTCAAGTTGAACGTTATGTTTGGTTGCAATTTGGTGATGATTACACGCGCTTGTTAAAAGCTGCATTACAATC
TGATGATAACACGAATTACGTaagtggagctttgacgaGAAATCCTCATATCgctgaatttaaaaaaaaattgaacgATGTGAAATTGGTGAAAACTTTC
GAGCAGCTTTTGAGCGACGGAGAACGCGTAGAATTGCTTCTGGAAAGCGTAGGGGAACTAGTGAATTTCAAATCGTCTCCGGGAATATCCGGTGTTGCCA
CGAACAAAAAACAAGATGAAATCGTCGAAAAGCTTCAATTGTTGGTCACAGATGAAGACAGTTTTCAGTTGCTGAAAATCTCTTTAAATGATGAACATCT
TGACTCGTTCTTTGACGCATTAGATGCACGAAAACATTTGAAATTGGTTGAAGACATGCTAAGCAGTACGGAAATCAATACCGTAAAGTCGTTTAAGGAC
ATTCTTGAAGACCAGAATAAGGTACAATCTCTTGCACAGGCTTTACTAACTAAAGAGAGTTTGGAAAATTTCAGAATGTCTTTGGACAACAAGAACATCT
ACACTAAAAAAAGGTCTGATCTGGTTGAACAAGAAAACTTGAAAGCGCTCGATGAGTTGTTGAATGATTTGGATCAAGTGTTTTTTCTCAGAGTGGCTGT
CAGGGATAATGTTCGTGCGGAATTGTTTCGAGCAGCTTTGGAGAAAGTACAAGGGAAGGAGTTCAAAGACGTATTGAACGAAGTAAATCCGGTGGAGACG
TTCGAAGTCGTgttgaacaaaagaaattTGGTAAATGTGTTCAAATCGGCGCTTGAAGATGAAAAGCAGCTCGAATGCCTTAAAAACGCTGTTTCGGTTG
AGCGTCGTGAGGAGTTTAAATCTTTTTTTGATTCTCGAGATCAAAAGATGTTTTATGAAGAGTTGGAGCAGCAGCTGCAACTTGAGGAGAACAGTCGAAA
GGATTTCTCGACTCGGGGCCCCCTTTCAACACCACCGTCTTGA