Transcript Name :
Plaha_PHALS_12057
Orientation:
(-)
Number of Exons:
1
Description :
C2 domain
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
C2 domain12.44PS50004
HmmSmart predictionP-Valprediction_id
C2 domain5.8SM00239
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-379
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1259 bases(100 bases per row)
ATGTCTTTATCTTATCCACTACATGGCACGCCTGTCGGTGCTTCATTCGACGTGAATCTCGAAATTGTGTCTGCACAGGTTAGAGCTTAACTATGGTTTT
CTATACGTAGACGTTGCTAACAATAATATGTTTCCATTGATAGGGTATTAAGGCTGGTGACTACCTGGATATCAAAGCAGCTTTTCAGGGCCACCTCTCA
ACAAGTGATGCGTTTACCGTGATTAAGGTTGACGGCGAGTCAATGGCCTGGACACGTCCAGCCTTTAGTACTCTCAATCCCAAATGGAACGAAAAGTTCT
ACTTTAAAAACGTTCCGAAAGACTCACACTTCAAATTTGCCTTGTTTGACGCCGACATGATCGGGGAGGACGAACTTGGAGAGGCGCACTTCAGCACTCT
TAGTGTTATCTATGATGTGGACACTGAGTTCGATCTAccaattacacaagacgatcgCAATGCTGGCATCATGAGCATCAAGGTGGGCATGAATGTTTAT
GTTCAGCTTTTTGTGCTAATGATAAATATATTGTAGGTCAATTTCACTCAGGTCTATGCCGATGACGATGCAGTTGTAGAGGAAGTCGGTCCTGTTCGCT
ACTCGGTACATTCCAGCTATTCAGCAGGCGTGTTTAAGAAGTTGACGTCTGAAGATGAGAATATCAAGTCGTTAGCCTACATTGTTCAACTACATAACAT
CGCTCTATACATGCCTATCGACTATCACTGGAACAAGCATTACCAAAAAATTCAGCGGGTATTCTCACCGGATCATGCAGAGGCACCTATTCTACGTCAA
CTGGTCAAAACACAACACGCTTTGGTGTATGAGCACAACCAGAAAAGCACGAAATATGGCACGATTAGGGCTCCTGGTGACTTCTTTCACCTTCTCCACA
ATGGAATGCGTGATGAAAAGCCTGTGCTTTTTACCTACGCAATCACATCAAACGGCTGGTTCTTTTCGGAAACAGGCGCCGGTTTCTTTAAAGATATGCT
ATCAAAGCACATGGTCCACTCAAATGCTGCCGAATCGGTCAAGTACGCGGGTGAATTTCGTATTGAAAAAACGAAGAACGGCACACGCAAACTAGTGATT
GACAACAATAGTGGCACGTATGCTCCACACAAAGAAAGCCTGCCACGTTTGAAACAATTAATGGAAAACAATTTTCCGGGTATCGTTTGTGAAGCGTTAA
ATCGCAATGATGCTGATTTGGTAAAACGGCGTAGGGAGATTTTGGACGCATGGGATTAA