Transcript Name :
Plaha_PHALS_12058
Orientation:
(-)
Number of Exons:
1
Description :
dna polymerase epsilon
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-533
NN-scoreoddsWeighted Score
0.621.7320.003
*** None ***
TypeScore
mitochondrial783
GO
*** None ***
KO ID
K02325
K02325
K02325
K02325
K02325
K02325
Cluster Id
1450
Sequence
        2055 bases(100 bases per row)
ATGGCTACCAAGCGAGTTTTGCGTGCGTGCAAATTACAAGGGCTATCGGTTCACGCCAACGCGCTCAAGCGAATTACTGAGGAACTCAACAAGTGCGTAT
GCAACTTGATCAATCTCGCTTTCTTTGATCTCTTTTCTTTACAAAGCTACAAAAGTGAAGCGAACTGTTGGCAGCAGCTCAAATTGATCTCTTTGATTTG
ACACTTTTACTTTAGTGATTCGTCGCTAGAGCTGGACGACATCATTTACGCCATTAAGAACAATATTGATCGTAGCAAATGTGCGTATGTGTATCGTGTA
TGTAAATTGATCATACACGTTAAACTGATGCGAGTTGTGTACttagtgacgtcgtcagtagTGACGCTTGAGGCTTTGGAGAGTGCATTAGACACGCTTT
TGGCTGTGTCTGCTGAAAATGATTATGAAAGAATTCAAGTGTTTGGCGCCTTTGACACGCCAAAGCTGCACTATAACTACCACAACAACTTATACGAGCT
GAAAGGAAACACTCATTTTGAACTCCATGCTGGCCCAGAGTCGAGAATTCAACTCCTCAGAAACCGATTTATGTCAATAGATCTCCGTGTCAAGCGAAAT
CGATTATTTGCGCCCCCATCAGCCGCGGTGGCGAATACGGCCGAGTACATAGAGGTGTGCGCTAAAAAACTGGAGTGGAACTTATATTGACTTGTAAAAA
TTGTGACTGTAGCTATCGCGAATTGAATCCTTATTAGGTACTAGTGGAGTACGACGTGTGATAGGCATGTTGGGTCAGGATGAACGCAAGCGCTATTACT
TGGAGGATTTCACGTCGCGAATTGTCATTGACCTCTCGGATGCAACTTATACGGATGGTCTTTTTACCATCAATTGCGTGGTATTAGTTGAAGGTGAAGT
TGTGGACGATGTGCTGCACGTTCAGGTAAATGTGAAGCTGACGATTCACTGCAGTTTTACGACTAagctaaaaaaaatcaattgatGTTTAGTCAATGGG
ATTTCCACCTCCAGAGACCAAGCAAGCGTCTTTGGAAGTCTTAGGTGGTCTTGATCCCCTTGCTGTAGAAGTGTCAGCTGAACAATTGGAGCAGATTCGA
CATTTGGAAGCCAATGACCACCATGCTACTTTTATCGTACTGTCCAGTGTACATTTGGATGATCCACAAGTCATGAGCAAGCTGGACGTGCTCTTTCAAG
GATTAAATACTATTCAGCCAACGCTCTTCATTCTAATGGGTGATTTTATGTCTACGTCAATCGGTCGAGGGGTGGGATCCAACTCGCTGCTGGATTTACG
TGAGTATTTAGAAGAGTTCGGCAACCTCATTCTAAAATATTCTGGCATTGCCGAAAATTCGCGTTTTATTCTGGTCCCTGGGCCAAACGATCCAGGATCT
TCACGTGCGTTTCCGCGTCACCCGGTAAATAAAAAATTGCTCATTGATGGCGCATGATTGTGACAGTATTACATCTTCATATTGCTTAAGCAGCTTCCTG
ATTTATGTACACGCGAGCTCATTCGCAAAGTACCAAATATCACTTGTAGTACCAATCCGTGCCGGATCCGCTACTACACTCAAGATATTGTCATTTTCCG
CGACAATCTTCAACAAAAAATGCAGCGGCATGCTATCCTGCCCCATAGACCAAGTGAACATGAAAAAGCGGTGCCGAGTGAAGATGTTGAATCTGTCTGC
TCCGTCTCTGAGATAGACATTTCCAAACATGTACGGCGACAGTCAATGTTTTCGAAATGATTGCGACTTATTTAAATATGATGTATATTCATGATTTCAG
TTGGCTAAGACTCTCATCGACCAAGCACATTTGTGCCCCATGCAGCTGATGGTGAATCCAATACTATGGGACTTTGACTCCTCACTTCAACTTTTCCCGG
TACCAGACATTTTGATCTTGGGTGATTCGACGGAGCAATTCCAGCTTGGCTATTCGTCTGTAGGTGTCTTTCATCCGGGACGCTTCCACACTGACCACTC
GTTCGTGCTTTATCGCCCGAGCACAAATACTACCGAATTCAGTCGCGTGGAGTAG