Transcript Name :
Plaha_PHALS_12051
Orientation:
(+)
Number of Exons:
1
Description :
Protein of unknown function DUF2807
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5210.60120
InsideOutsideTMhelix
509-525
1-485
486-508
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
5081
Sequence
        1578 bases(100 bases per row)
ATGAAGCTCTCAACTTGCGTGACAGCATTAATTGTTGGCTGCGGAACTTCGAGTGCTTGGACTTTCAATGTGTCGGAGGTGGCACCTCCTGAAGACATCC
TTGGCGAGCATCAAACTCTCCAGCGCACCTGGGTAGTTTCTAGCTTCACTCAATTGGAGCAGCTATACCTGGCTGTGCCTGGCCCCGTTTTTGTGGAGTT
GGACCCGTCTCTTCTTCCACCGTCGGAAGCTCCAATGAAGGTGCCAAGTACTGATACACCGGGTGTTGTTCCCGGTGTGACCCCTGGTGTCGTGCCTGGC
ACGGTCCCTGGAGTCATTCCTGGATTTGTACCTGGCGCGACGACTGTTGGATCTAGCGCCGGCTCAGAGTGGAGGGATAGCAGTATGGCGGTCGCAACTA
TCGAAATACCGACCTCGATGCTGCGCAAACATCGCCATCAAGATGAGAAGAGTGAGGAGGCAGTCGTGGCCAAGATCGTAGTTTCAGGCAACTCATCGGA
TTTGCTTAATATGTTTCAAGCCGCACCTTTGCATCCTCGCCGAGACGACAGTCTTAAGCTTCATTTGATGAATGAGGATGCATCAGGCGAAGGGTATGTG
CAGACAACGATCTATTTgttcaaaaaaaattcagtGCGCCGTGTCACCTCAGCCTTTTCAGGCGACGTCGTTCTAAATGGTGATACGATAGCGCTGGACG
ACTCCGAAGCTGACATCAAGTTTGCGTGCGTGGGCGACGGTAATTTGTATTTGCAATCCGATTCGAATGCCACGATCGGATCATTAGAAGTGGAAGTCAC
AGGCAGCGGTCGGGCCCAGCTGACGATTCCTGAAGTCATCCTTGAGAGCTTTTTTAACGTTGAAGTCGCAGGTAACGGTACGGTTGCCCTGTTGGCGGAC
ACCTTCAGGGCCAACGAAGTGAAGACCACGGTAGCTGGGTCTGGTACTATTGTGGTGGAGTCTAGCGACCTGACTTCACAAACGCTCAAGGCCTCAGTAT
ACGGATCAGGAATTTTTAGCTTTTCTACGTCGGGCTGTGTGACCAAGGAGACGCTAACGCTGTCAGGCTCAGGTCAGCTTCTTGTTGGTTCCATCATCGC
ACGGCAGGCAGACGTGGACGTGTGGGGCAATGGGGAACTACTCGTACAGGTGACCGACAAGCTGACGGTGTCCACATCGGTATGGGGAAAAGTAGGCTAC
GTGAATGCACCGCCGACTGACATTAAGATCAAGGGCTGGTGGTTCTGGCGCGAGGCTAGCTCTATTGTCTACCCCTCAGCAGTAAACAAAGTTGCGATCT
TCGAATCAGCAATTGTTCCCGACAAGAAGCCAGTATACTACTCCGTCGAAACTGCTGAGTCCGCGCTGTCCGATGATCCCGACTTTTCAATTGTTGCGAC
TAAGCAATCCAGCACAGTTGACATGATGTCGACGTCACTTTCGAGCATACAGCAGGTCAGCGGATCGAGCAGCCTATTTTACGCGTTTATCGGCGTTGGC
GTGGTTGTTGTAAATGTAGTGGCTGCGCGTTCATGGGCGATGCGCCGTGTGCACTGGCGCTACACTCCTCTGCTCTGA