Transcript Name :
Plaha_PHALS_12044
Orientation:
(-)
Number of Exons:
1
Description :
n-acetyltransferase 9
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-189
NN-scoreoddsWeighted Score
0.7873.8080.008
*** None ***
TypeScore
cytoplasmic565
GO
*** None ***
*** None ***
Cluster Id
5099
Sequence
        965 bases(100 bases per row)
ATGAAGGCAAACGAAGGCGTCGTCATTGTACGTTGCGCTCTGATGCTTTAAGTGCACGGATAATTACAATGATATGGTAGACCGGACAGAAAGTGACGCT
GGTCCCGTACGAAAAGGAGCATGTTCCCAAATACCATAATTGGATGCTGGATCCGTGGCTGCAAGGTGAGTTCAGTGACGAACGCCACAACTTCCTCTAT
GAACTCACCGATGCGGTGTACTTGCTTCAGAAATGACAGCATCCGAGCCATTGTCGATagaagaagaatttgagATGCAGAAGACTTGGAGAGAGGATGC
CAAGAGTACGACTGCACATGCACTGAACATCTTGAGCGGCGTTTACTCAACCACTGCTGTATTTTTATATTACTAGAGTGTACATTTATCGTTTTAGCAA
AAGCAGCGGATGACAGCAATTCTGAAGTGTCATATATCGACGAAGGCGCGATTGATCGTGGGTGATTCAGGACTGTGTTTTGACTTGGTTGCAAAGGCTG
AAGTTTGAAGTGGCTGGGTGTAGGCATGGCTGGAGACGTAAATCTGTTCTTTAATGACTATGACGACCCAAATGCTTGCGAAATCGAAATCATGATAGCC
GAGGATAGGTATCGTCGCAAGGGCTTTGcggaagaggcggtgaagcTCATGATGACATATGGTACGTCAAAAAGGTTGCTGCCATCTAGCCAAGCAGCAC
GATGAAACAAGCTTGATTTGACATTAACTGCAACGAACAGCTACGTCAACTCTCAACGTCACCCGATTCGTCTGCAAGATCATCGAGACAAATTTCGCCT
CACTTCAGCTCTTTAAAAAGTAAGCGGGGTAATTATTCCTTTTCACGTTCTATCGTTTTGATGTGCTTTTGAAAATGCAGGCTGGGATACGTAAACTACA
ATTATGTCGCTGCTTTCAATCAGATAGAAATGGAATTTATCACACAGAGAAAGCTGATCGAGTGA