Transcript Name :
Plaha_PHALS_12045
Orientation:
(+)
Number of Exons:
1
Description :
Rab6 GTPase activator GAPCenA and related TBC domain proteins
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Rab-GTPase-TBC domain28.741PS50086
HmmSmart predictionP-Valprediction_id
Rab-GTPase-TBC domain4.9SM00164
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-621
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2512 bases(100 bases per row)
ATGACGTCGACGGCGGATACTGTTCATGCGCTGTTTGCGGAGGCTGTGGCGGTCATTGTTCGTCGTGGGTGGATTCAGGTGATTTTCTGATGATAGGATT
TGTCTTTTATTCTTTATTGACTCTTGTGGGTATTTGGACGTGTAGACTGACACTGTGGAGGCTATCGCGGCGGTCGACAAGAGTCTAAGATCGCTTGTGG
AGCGTCAGAAACTCCGACGATTAGCTGTTTGGATCTCAGGATTTCCTGATGCGTCGAGATTTCGGTATGTAGTAATCAAAACTTCAAAGCTGGCAGATCG
CCTGACCTGTCAACGTTTTGTTCAAGCTATTGGCTGCAAGCTGGAGATGTAGCGACGCTAATCAAGGATATTCCAAAAGGAATGAGCAGTCGAGACTTCT
ATTTACGGGTATTGGTTGCATTAAACATTGCGAGATGTGTAATCGGGTGACTGATTGAGGGATGTAGAAGGCGGACATAAAAAAACTGGAAGATAGGGCG
ATACTTAAAGCCACAGGAGTAGAAGGTGAAATCGACCGCGACATTGAGCGCACATTTCCTAATGATCGTTTTTTCTCGGATGATGGTAATAAAGGCTGAC
TTATATTACggtgacgtgcggcactgaCTTAGTTATTGTATTAGGTGACGGTAAACGTTTGCTTGGAAATGTACTAAAAGCCGTTGCGCTTTATGCTGAT
GACGTTGGGTATTGCCAAGTATGGACAATCGGTTCTAAGTCATCTACTTGGTGATATAAAATCTGATGATACAATTACCGTGACAGGGGATGAATTATGT
TGTCGCTTCTTTGCTGCTTGTGATGAAAGACGCTGAAAATACTATGGCGCTTAATCTTGACAATTTCTCTATGCAAGAGGTCGCATTTTGGCTAACACTT
GCTTTGATTCGACGCAAAGGGATGGACGAGTTGTGGAAGCATAAGATGCCAGGGTTAGCCTTCTTCATACAGTGTTTGTTAAGACTTGGTTGCTGATATT
AAATGATCACTTTGATGGTGCGTATAGGCTCTCGCGATGTATTTTTCTCTTCCAGCAACTTTTAAAGCAGCACTTCTATGATCTATCTGCCCACTTTCGA
CAAATTGGAATGCACTCCAGCATCATGGTCACTCAGGTGATTGCGTCAGCACTTATCGTATCTAGAGCTAAGCATTCAAATTCGATTTGATTGTATTTTT
CGATAGTGGTTTGTTACAGTGTTTGCTCGAGTTCTTGACACTCAAACACTTGTTCGAGTTTGGGATCTAGTCTTTATGGATGGATGGAAAGCTGTATATC
GAGTAGCTCTCGCCCTTATTGCAAGGTTACGACCAACGCTTCTTGCCATGGTAAGGACCCTCTTTGATGTTGATAAAGTTGGCAGTGTTGTGCGTAGTAA
TTTCTTATTGTTGTTCATTTGAAAGGACCTTGAGCAGTGCAGTGAGTTCTTACGATGGAATCCCAAACTAGGACTAGAAACAGTCCTAAGCCCTAGTATT
TTTCTTGAACATGCGCTGAGCTACAAAGTGACTCGCTTCAGTTTGAAACAATTGGAGGAAGAGCGACATCTTGAGGTGAGAAATAATACAAAACTCTGCA
AAAGTATTCACTTACTTTGGCACGTAGTATCTTCGTCTCCGTTTGCAGCAAACGCCATTATCAGAGGAGCATCGCTTGCTCTTCCCAACACTTCAACAGG
ATGGTGACATCAGTGCTAAAAAGAAAGCTCTTGAACTCATTCGCTCAAAGCTTGAGCGCTATGACACAGATGTTGCAAGTGATACTATagttcttcaaaa
caaaatCGAAGCCGCCGAGAAAGCACATGCCTCGACTATGTCAGTTTGCTACGCCATTGCTTACGAGTTGTCCGAGTCTACGATTGAACTAAAAGAGCGA
ATTGAGATAAAAAGGCGTCTACGCGCCAAATTTCGTTCGCGATTGAATACCGCAATTAATGAAGCGACCACATCATCCTCTGCAAACGCTTCAGCGCCGA
GATTTACGATGTGGGGAAATCCGTTTGAGTTTCTTAACGAACGCATGGCAAGTTGTTTGGATCGCTTGCCTCTTGTTTCAAAATGGTTGGACACTGAACA
CGAGCTTCATGTTGCTAATATTGAAACTGATATCGAAAATGATGAGGAGACACAACGAACATTACGGCACCTCGAGATGTTGGTGCCACACTTAACAGCC
GAACTGCGTTTATTGCAACGCTCAATTGCTTACAACGAGCGCTTCCTGCAGCCCTTGTTACAACGAACACGGCTTCTCCAACGTGACGCCGAGCTGGCAC
GCATTGAAGTGGAAGAAGCGCAGGTTTTCAAGGATCGATTAGCCGATCAATTGCTGCAAATCATGCTGACGAGCGAAAAGCTTAAGAACAAACGAATGCA
GCAGTTATTCGCAGAGGTTGACCAGAACGGCAGCATGAGTACGTAAAGAAAAAGATTGAGGGTATCTACTGTATTAACTACCGGTGCGGAAGCTTCAGAG
TCAAAGACATGA