Transcript Name :
Albla_Nc14000190
Orientation:
(+)
Number of Exons:
5
Description :
IQ and ubiquitinlike domaincontaining protein putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site8.352PS50096
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
Cluster Id
570
Sequence
        1827 bases(100 bases per row)
ATGTCCAGTTTCCCTAATCGATCATTAGTTGTCACAGAAAGCACACAGCATTCAACATTTAAATGTGAGAATTTTCACACAGCCATTTTCCGTCTCAATT
TGTACCACTAGCCGTCAAACGTCCGTTCACCTCTGTGTAGCGCAGAAACCTGAGAGATGCATAGCTACACAGATGATAGGATAGGGAAAAGGCAGGAAGA
AGACTCGCAGCAAATAGGTTTGTTCGTTTGCGAATTTGGTGCTGGGTCTCATTTTCTTATAATTCACATGATCCAATAGAGAGCCTCGCGAACAACACTA
AAACCGAACAGTGTGTGGAGTTTGAATTAACACTTTTGTTTGAGGAAGAAAATGTTCGCCATAAAGTTGCAGTAACCCCACAGACGTCACTCGGGGAACT
AAAAGCATTGATCAGTAGCGATTTGCGACTTCATGAGAAATCCCTGATTTTTCCCAAAATTCAGCTCCACATGTGTGCAAATGATCTAACGTTAGCGTCG
CTCCACTATCCAGAAAGTAGTGTTGAATCAGTGCTACATGTTTCTATTGACAAACGATTTGATTTGAATGGAACGATTGATGGATTTTCTTGTGTGTGAC
CTACTACCATTAGATTTCAACCAGGTTCTTACAGTATTGTAGTCTCTGTAGCATCGAGCATTAAGGATCATCAGGCTGAAGCTCAGAAAGAAAAAGAGTA
CCTTGGTGGGTTTCGCCATGTTAAAATGGAGCAAGTATTTCACCACGCTGCTACCCAGGTATGTCATCTATATGATTGTGACAAGTGCTTCTCTTATTCA
ACATTGGGTGCAGACTTTGTCAGGTAAAACGAGAAACAAGAGGGAGTCGTACAAAGTTCAGCGCGAAACACAAACGCAGGAGCTGATAACATGTTCACAA
CAAACTTATAGAGAAGCAGGGACTCAAATGAAGCGCAGTGATTTGTTCTTGTACTCAAGAAACGATCGAGCAATCATTACGAGGGCTTACGTTACCTCTT
CTCAATTAAAGGTGATCTGGGTGGCAGCAGCTAGTTTAATTCAACGTTTGTATCGAGGTTATGTGGCAAGGAAATCACTAGTTGAGAAAATTTTTCGGCG
AAAAGAACATTATGAGAGTACCCGTTTAAGAGCGCTCAGATCGAATGAGCTTCAGAATCGCCATCAAAAACGCGGAATGCATCGTCGTATGCACCCAAAA
ACCGCGCATGACTTTGAGATATTATACAATGACCTTCATAGATGGAGGCAGAATGAAAGTGTGCAATTGCTAAATGGCTCTACGGTCAATACCGAGTCCA
AGTTGAGAAAAGAAATCGAACAGCTCTCTGGAAAAGAAACTCATTTGCTGCATACAATCGAAAGGTTGAAGATGTCGGCGGCGCATGGAAATCGAAAACA
ACGAACTTCAGAGATGTTGCAATTCATGGCACGTTCAAAGAGATGGCAAATGAGCGATGGAATCGTAAAAGAAGTAGAGACACCTTTTACAATTCGAGCA
AAGGAATTGTTGGATTTGTTTGATGCGTTGAAAGAATATCCAGTACACATGACCGATCGTCTCCAGGTTTTGAAACAAGTAACACAGACAGTACAGGAGT
GCGAATCTGCACCATCAAAAGAGGTGATAGCTCTGATAGACCGTGAGACAGATTTATTAGCTCGAGGTCGAGCCGAGAAATCATTAGAGGGCCTCCGAAA
GAGAACTCTTCATGCATTTCTGAGATTCGTTGAGTCTCCGACGAGTAATCCTGGAGCAAGCATTCCGCAGATGGAAAAGTCAAGGCAAGATCGGAAAGAA
AACAAAACACTCACAAGTAAGACGTGA