Transcript Name :
Albla_Nc14000380
Orientation:
(+)
Number of Exons:
15
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Src homology-3 domain13.613PS50002
Zinc finger, LIM-type7.237PS50023
Zinc finger, LIM-type9.603PS50023
Zinc finger, LIM-type12.355PS50023
Zinc finger, LIM-type9.89PS50023
Src homology-3 domain14.465PS50002
HmmSmart predictionP-Valprediction_id
Src homology-3 domain2.5SM00326
Zinc finger, LIM-type3.6SM00132
Zinc finger, LIM-type6.9SM00132
Zinc finger, LIM-type2.2SM00132
Zinc finger, LIM-type2.5SM00132
Src homology-3 domain3.9SM00326
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
KO ID
K05760
K05760
K05760
K05760
K05760
K05760
K05760
K05760
*** None ***
Sequence
        3040 bases(100 bases per row)
ATGTCTTGTTCCGATAATCCAATACGTTCCGAATACGCGTCCAATGTGCTTCGATCGGCTGCCTTTTTCGACAGACATCAGTCAGTGACTGCACGCTCAC
TTTATTACATCTATCGCCTGCATCTGCCTCACATTCTGCCAGTAATAATGTACGACCTGTAGTACCGCCTCCAGTGCCCAAAGAAAAGGCGATAGCGCTC
TACAATTTCATTCCTCAGGTACGCAATTGTCTTTTCATTCGGGAACACACACAAATGAGTTTTGAAATAGGATCCCGATACGCAAATTCCGCTGACAAAA
GGCGATGCAATTGTTGTCATTCGAAAGGTGAGGCGAAAGGGTTCATCGTTGGGAATTAAAGCTGATTGATGCGTTGGATTTGATAGGATGCAGACGGATG
GTGGCTCGTGAAGAAAGACTCGATCAAAGGCCTTGTGCCCGGGACGTATGTCCAGCTGGAGAACACGTCGGGACTGGACGTAGATGTCATACTGGCGGCT
CGAGAAGCGTCTAACAAACGGATCTTGGAACTTACACAACGAGAAGAATTGTTGAGGAATCAGCAGGAAGGAGAAGCATCTCGAACGGAGCGACAACACA
GCCAGTCTTCTCTATCGCTATCGAGCTCACCTAGAAGCAATGGAAAAGCGATTCCACGAAAATTAAAAAAGTGTTTTGCTTGCAACGAGACAATTTTGGG
ACGCACAAAGACCGCAAAAGGGCAAATATTTCACGAAATTGTACGATATAATAGCTGGAGTGCATTCCAAGACGTGAATCATTGTCTGTGAACTAGTGTC
TCCTTTGCAAAGGATGTCGAGAAGCTATTGAAGAAGACGAGGATTTCACATTGATTCGAAAAAAGGTAAGATGACGCCTTCTCTGTACACAATCGAGATT
CATTTTGAAGTCATCTACAGGCTTACCACGTGGACTGCGCCGAAAATGTCGTACAATGTAGCGTCTGCCAAAAGGTAGGCTTTGCAGTGTACGCATTGAC
ACTCGGGTAATGACTTGTTCTTTCTATTGGTGTAGGAGATTCTCGGCCGGATACATCGCATAGGAAACCAGACGTATCACAAGCTTTGTATCCAGTGCTC
GATTTGTGCAAAACAGGTCGCTGAAGGTACATGGACATTAATTGATGCGAGGAAATATGGCGTGTTACGATCTTGATGTCCAACAAATAGCGGATGCAGA
GTTGGAAGGCGAAGATGTCATATGTGTCAATTGCCGCGTCATCCGAGGTAGTGTTGTAGCACATCGAGTTATCCCCGAGACGTGTCATTATCATTTGTAT
ATGCCTTAGAGCGCGCCAAGCAAGAAGAAGCTCAGAGAGAAGCAGAAAAGCGAGCAGGGAAACATGCTCAGAGGCAAAAGATTGAAACCGCTAAGCAGCA
AGAACTCTTGGAAAAATCACGTAAAGAAGAAGAAGTAGCAGAATCAAATCGTCAGAAGGATAAGCAAGTAGAAGAACGCAAAAAGTTAGACTCTCACACA
AGGAAAGAAACTGAAAATGCAAGAATTGGTGAAACACGAACTGACAAAGAAAGCTCTCTACCGTCTCCATTTCCATCCAGTTCGAAAATCGCATTGGCAA
ACAGCAATCCCACCTCAGAATCGCGTGCCCGGGGCTCTAGTAATACGAGTTCGTTGGGCGAGTTTGATCTCGCAGCGAGGAATTCAGCTTTTGTGCACGA
CGAGCGACTTTCCGATATGTCAAATTTGGATGGAGACTTTGATCCACGAATATTTGGCAGTGATCGCGATTCCTTTCGTGTTTCTGAGGTACTGGATATG
GAAAAGATCAAAATGCACGATCAAAATGGCGCTTCTCGTGTACGGGGTGCCACAGTCGATCGACTATCAAATATCTCTGGGTTTTCTGATCTTAGCGATT
TGTCCGACAATGATCGGATGACGGCCTCAAGTCAGAAGCGAGACGATGGAATGACACGGACGACATCTGTGGTGCAGGAAGAAGAAAACAGCGATCAATC
GATTTCGTACGAAAAGTGCGCTGGATGCGATCAGATACTAGAAGGAGAAGCCATGTCGGCTCTCGATCAATATTTCCATCCGGAGGTGAGTAAAACTCCA
AATAGAAATTATCAGCTTCTCATTGTGGTCAATTGTAGTGTTTTAAATGCAGCGAATGCAAGCACGTCATCCCAGAAAGCGAAGGCTACGCGGAACATGA
AGGAATGGCTTTCCATCAGAGTTGTTACCAAAGTCGTTTCGGCAAGAAATGTGTTCGGTGTGAAAAGGTTTACGAGCTCAAAGTATGTCTGTATCACTTC
TCCTCACGCATTGTTCTCCTTGCAGTCTTTGAAAGGCAAAGTCATCAAAGCACTGGAGAGTCTCTATCATCCAGATTGTTTTGTTTGCCATCGTTGCAAT
TCTTCGCTCACAGGTGCGCTGACAAACTCGACTATCTTCACCCATTCACGCGATGCTTCTTAGAGAGTTTTTTCGAGCATCAAGGGAATGTTGTCTGCGC
AGGCTGTAAACATGATCTGATTCGAGTCCAAGTACAGCAAGCAATGTACGATCAAAAGCTGATACCACTTGAATTTGTTATGAAAGGACTCTGTAGAACC
GACCCAGAAACGGTGCTTTTCGCAACCGCGGCGTACGAGTTTGTGGCCGAGGTACGTGATACCCAGGCTCAAGTCAGTAGCTGTCAAATCTCATTTTTTC
TTGCAGGACGCTTCTCAGCTTACCATTCGACCTGGCGATTTGCTACAGATTTTACGCAAGGTACACGCTTCCAACAGCTTCTTCAGAGTTGATCTAACAA
TCCTGCTAGGATCCTGATGGATGGTGGTATGCTGAAATGGGTCAGCAGCGGGGATACGTGCCGGGCTCCTACTTGGTAGTGCACCCAGCCGGAAAGCCAA
TTCAGCAATCCTCCACACAAGCGGCATCCGCTCACACTAAAGCAAACTCTTCCAGTCAAGCTCAATGCGCCAAATGCGCTACATCCAATCCGCGTGTCGC
TCGCTTCTGTCGAAAATGTGGAAACAATCTGCAGAACTGA