Transcript Name :
Phyta_totarag14596
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_424253
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-156
NN-scoreoddsWeighted Score
0.5381.1530.002
*** None ***
TypeScore
cytoplasmic652
GO
*** None ***
*** None ***
*** None ***
Sequence
        471 bases(100 bases per row)
atggagaagatcaacaaCGAAAAAGAAGCCATGCTGTTTGACAGTGGTGTCGAGGTGTCTATTATCGACACCGCTTTTGCTCGTAAGGTTGGGTGCTACA
TTGACGAAAGTCAGACATTGGCATGCGAAGATGTTAGGAAAACTCCATATATTGCGAATGGTCGTACCATACTCAAGATCACTCTAGACGGATCACTGAT
CTACTTCTTCGATGTGTGGGTGGGCCCACCTACCGGCGGCCAGGACCTGATCCTTGGTATGGACTTCATGGCCCCTGCGGGTATCTGCCTCGATCTTGCT
GACGGCACCAGCTACCTTCCCGAAGAAGTGCGTATCCAGCTGTCCGGTAGGCGCCCGCTCTACGGAGATCGCGTGGAGCCGGTGATCATGAAGGAAGATC
TCTACATCGACGTCGGAAGTTCGCTGGAGGTCAAACTTCACGCAAACAAGGCAGAACGTCAGAAACTTTAG