Transcript Name :
Phyta_totarag14336
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-77
158-175
233-251
312-322
381-386
455-474
593-619
101-134
196-209
275-288
346-357
410-431
498-569
78-100
135-157
176-195
210-232
252-274
289-311
323-345
358-380
387-409
432-454
475-497
570-592
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2515 bases(100 bases per row)
ATGCCTTTGGTCAACGCCGATGTGGACGTCCCCAAACGCCTGTCGTTCTTGAGTACTGGCTTGCAGACGAAAGACATTGAAGACGGCTATATCGGACTCA
AAACACCCGAAATCGACGGTGGAGCCCTCCGCGAAGGAGGTATGCCTGTGCTCACCAGCAGGGACAACCTCGGACCTCTCTTCTAGTACGCCACTGTCGG
TCTTGTCTACGGTTTGCTACCCGAAACGATCTACCCGTTCATGCAGAACTACCTCAACTGCTCTGGAGCTCAAGTGACTGCAGTTCAGCAACTTATCGTG
CTACCGTGGAGTTTCAAGGTCTTCTACGGCATTCTGTCCGACTGCCGACCCATTTTCGGCTATCGGCGCCGCCCATACATGCTCATCGGCTGGGGTATCT
GTTTCATTATGTTGTTGATCATGGCCATCATGCCTATCGGTCAACCGTACTTCACTGTTGCTTCGGACCGCGACATCGACATTGCCGACTACACACCAGA
AATCGAAGCCCGTCTTAACCACAACGCCCCCGACGATGGCGCCAAGTACGTCATCATCAtgctgtttgctgctgtcgggTACGTGTTGGCCGATGTCTGC
GCAGACAGTATCACGTGCGAGTTGGCTCAACGCGAGCCTATTGACAAGCGCGGCAAAACACAGTCCTGTATTTACACGGTCCGAACTGCGATGGTGATCT
TCGGCGAGATCCTAGtgggtttcttcttcaacggcGAAGATTATGGaggcgacttcgacttctcgCTCAGTTTTCCGCAGTTGATGATCATCGTAGCAGT
GCTTACACTTCCAGTGTTCCCGATGACGTGGTTCTTcatcaaggaggagaaaTCCTCGGCCGCGAACTTCAAGGAGTACATGAAGAGCTTCTGGGACTTG
TTGTGCTCCCGCGCCATGTACCAGATCATCGCCTACCTGTTCTTTTCCGGCATCTTCGCCAACATCACGTACACTGGTAGCTCTCCAGTGGCATCGAAAA
TGGTGGGCGTCACCCCAATCAACAGCACATTGAGTAGTATTCTCAGCAACCTCTTGTTCGCCGCAGGAATCATGATCACTTCGAAGTGGGGTCTGCACTG
GAACTGGCGCTGGATGACCGTCGTCACTGGAGTtgtggtggtcgtcgtggaCTGCACAGTGTCGCTTCTTGTTATCTGGGACGTCTTCCGGAGCCAGTGG
TTCTGGCTGGGTCCCCCCATTGCGGTGCAACTTCCGTACGGCGTCGGCTGGATCATTTCGACGTTCTGCGTGGTCGAGCTCGCTCAAATCGGAAATGAAG
CTGCGGTCTACGGCCTAGTTACCACGGTCACCAATGTGGCTCAGCCTTTTGCGACGTCACTAACCCTTGCGATCGATGGTCCGTTCAGCGTCACAAACGA
AAGAGTGCAGGCCGATGACCACTCGGTTCGTGCCGACATCACGTacaccatcatcatcatgtACGCCATGACCATCTTCTCGTGGGTTTTCCACTTCCTG
CTGCCTCCACAGAAGGCGGAAACGCAGGAACTCGTGCGCAAGGGTGGACACAGCAAGCTTATCGGTGGCGTCACAGCGTTCTacctcatcttcgccatct
ttTGGTCCATTATGACCAACATCATGGCCATGTTCGACAGTACGTCGTGCTTGATCATTGCAGGTGGAACCGGTTGCTAATACAAAGACCAAGTTACACG
ACGGTCCGTCCTTGACAATCTCGAAAGACGTAGTACATGCAGTTTAATGTTTGTAGTCCACGTTTCGTTCGAGGATACGCTCTTGCTGTGTGATGCTTGG
TACAGTACCTTGTTGTTGAAGCCATAACCCACTATAATAGAAAAACAGCGACTTGCCGAATCGTAAAAttgtcgacgaagatgctACTTTTTACAGTATG
TATCAGCTGCGCGGATCTCGTCACgtcagctacatgtacgtgaATACATGTGCCTCCGTGAATTTGATGTGCAAGCGAGAGCAACTTCGACCCAGCTTTG
TGAGTACAGTATCAAGGATCAAAAGGAGACTGAAAAAAGAGCCTGGAACAAGCGTTGGATGATCGTCATCTGTGGTAATCATTGTCGATTGCCCCGTAAC
GACGATTGTCGTCTGGGAGATTCTGTCTTGGCCCTCCCATTGCTGAACAGCCCCCGGCTGGCGTTGGCTGGATCATCTCGTCGTTTGTGACAGTGGAGCT
CGAGGGACTACCGGTAGGCAACCAAGCTGTAGTCTACGGTCTACTCACGACCGTCACAATATTGCATCGCCGTTTGCATCGGCGTTGACACTCGTGATCG
ACGCTCCGTTCAACATCACCAACGCGCGCGTCCAAGAAGACGACTACACCATTCGCAGGGACCTCACCTACACTATCATCATCATGTACGCCATGACAGC
CTTTGCGTggagcttcttgttcttgctaccgaagcagaaggaggacacACAGCGACTCCTGCGCAAGGGGGGCAAGAGCAAACTCATCGGCGGCATCACG
ATCTTCTATCTGTGA