Transcript Name :
Phyta_totarag14316
Orientation:
(+)
Number of Exons:
8
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Chromo domain/shadow13.227PS50013
HmmSmart predictionP-Valprediction_id
Chromo domain/shadow3.8SM00298
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Chromo domain/shadowIPR000953
*** None ***
InsideOutsideTMhelix
1-731
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3870 bases(100 bases per row)
AtgtcgcctgcagctcccGGCGCTCGACGTCCTCGCAGAGATCACACGTCTCCTGTTACAGCTACGTCTCCAACCGCTACATCTGCATCACCGGCTGCTG
CGACCGTTGCGCCTCGAGCTCCAGTTGCGAATGCCACGCCTCTATCTTCGTCTGCTACGTCTCGACCCTCGATTgccgcgtcttcttcaactaCGAATGC
ATCTCCTGCAACGTCGGCGTCCACGATCGACCTCGATTCAGCTCCCACCATTGACCTCGATCATGTGCATGCTGATCCTGATCTGGCCACAGGGCTGCCA
CCGGTATTGACAGGTTTCCGTTTGCTGGCCGccactgcttctgcagcCGCCTAGGAGCCCCCTACTACCGCtaacgctgctgctgccggccCCGCTGATG
ACACGCCATCGTGTCCTGAATGCGCTCGCCATGCGTCGGCCCCAACGGTGCACCTCGATCGATCTCCTGCCAATCTCTCTGCTGTCTATGGATCGCTTCA
GGGCGTCCTGGTAGTTTtgcacgagatcgagatcgcTGTGCGACGAGAGCCCGAGTTCCAGCAATTGCAGGAAGAACATGTCAACCTTCAGCGTGCGTAT
ATCTCGTCTCTTCACCACGCTGGCAATCTTCACCGACAGATCGCATCcgccacagctgctgcagtctcaTTCGTCTGCTACTGTCACGGTCGGCACAATT
CCTTGTTCGGCGCGCTCCAAACGGAGCATTCTCAACTTGCGGAGTGCAACTTGACCGTagagcagctgaaggaggcggTCGACTCGGCCATCGCCTCCAA
CAAGGCGCACATCAAGTCTCAAGCGGCCTCTGCTTCGGCAATCCGTCATCTTCGGCGTCGTGTGGCCGCGCTTGAAACCTTGACCACAAATCTCGAGTCT
CAGCTCTCTGCCGTGACGACTCAGCCCGATCTTGgttcgcctcctcctcctggtcTCGCGCGTCGTCTATaagctcaagatcaagcgTTGTCCGATGCTC
TTCGAGATCATGATACCGCGCGGCAGCGCTGcgaagcactgctgcagtcggAGAAGTCATTAGAGGACGCCGTGGCTCAACTTCGTCGCCAGGTGGAGGC
TCAAGATCGAAGAGTCACCCGCCTGAGCGAAGAGCAAGATAACTTCCAGGCTCAGAGCGAGGAGGCCCAGGCTGCTCATGGTGAAACTGTTGCCCGCCTT
GCGCAGAGACTGACCGTTTGGAGAAAATTCGCATTGATTTCCGGTCGCAAGAGGCCCATTTCTCGTCCATGAGATCAACTATCTCTCGATTGGAACAGGA
AGTGGTCCGATGGCGCGGGGCACACGCTAGATCGCCGGAAGTCctcgcttctcgtcgtcaagATCGTGACGACCTACACCGTGgccatgatcttctccat
gGTCACTACGTAGATGTCCACACGCGATTTTCCGCCGTTGCGTCCGCCATGGGGCACCTAGTGTCGGCACCTTCGCCGACCACCGTCGGCCGGCGCAAAC
CAGATGGCGAAGCCAGCTTAGACCATGCATGAAAGATTCGCCGGACTTCGTCAGGGTCGCTtagttcttcttctgcacgTTTGAGATCTTCGTCTCCTGT
CCACACTCCAGTGCGTTCTCAACTGCGTGTCTTGTCATTGACTCGCTCGCAATCTCCGCCTCTGGCACCTTCACGATCGAGATTGTCGCCCCCAGTGCGG
ACACCTGTTAGCTTGAGAAAAGTGAAGTGGAGGAGCGTACGGCGCTATTGTGCGGAGTCTACCGGAATGGAAAGTGATCTCAGCTGCGTCGCAGTACAAG
AGCGATCTGACAGTCAACGAAGCGAAATATCACGGTTTGCTCCTATGCTTCGATCTTCTGGCCGACCTGGACAGGGGACGGCTAATTATCTGCGGAGATT
CGAATTTTGGACATCCGACAGATGCGAGGTGAGATCGAGTGCAAAGAACCTGGGTTGAAATTACTACGCCAGCAGGCTATGGAATGCTTGAGATCGTGTC
CAAGTCACGAATTCCTTCATATGAAGCGAGACTGGAACCAAAGCGCAGATCGACTCGCCGGCGCCGCtcgtcagcgtgaaggaggAACGGTAGTGACATC
GGAGGAAGAGTTCCAAGATTTGATGACGCTTAACCGTCTTGACGAGATGCTAGTTCCCCGATCGGACAGATCCGTGACCAAGCCCACGGCCGCGACAAGA
TCGCGCAAGCGACGCAGCCTGGAAGTCCTAAAGGAGGAGATTGTTCAACGAATGAGGGAAGAACGAATCTGTCTGGCccaagacgaagagcagTGGATCG
TCGAACTCAAGCAGTATTTGCATGGGGACGTAAAGGATCTGACCTCATCGGACGCTAAGAACTGCGCTAAGATTGCTGAAGATTACGAGATCGACGAAGC
AGGCTTATTGTTTTACTGCCCGCCGTCCAAACGGTCGAAGGAAGATCGTGATCTCGTCGCTCGACTAGTGATTCCCGAAACACTGCAAGAATATTTCCTG
CATCATTACCATGCCAGTCTGGAAGGTGCACATCGGGGAATCGGGAGGACGTACCATCGGATCAAGGCACATTTCCATTGGTGAAGGCTGTACTAGAGTG
TGCAACGTTACGTGGGTCAGTGCGTAGACTGTGAGACTGGAAAAGGGAGACCAACTGTGCGAGGCGAGTCGCTGGGCGACCTGCAGGCGACATACCCGTT
TCAGATCATTGCTATGGACCACATCCCGTCGCTACCTCGATCGTATAAGGGCAACACGGAACTATTGATCTGAGTCGATCTCTTCACCGGTTTGTGATCG
CCAAAACAAGCGCATCAAGAACTGCTCAGACGATTGCGGAGAATGACGAAGAGTGTGTTTTCCGACGATTTGGTGCAAGTGAAGCCATCCGGCATGATCG
GGAGCCAGGTTTCATGTCCGATTTCTTCAGATCGTTCAACAAGATTATCGGACAACGGCAAAGAGCGACTATGGCGTATCGTCCCCAGGCGAATGGAACG
GCTGAACGAATGGTGCAGACGTAAACGCGAGCGCTGACGATGTACGTCACAGACGTCAACCAGAAGGATTAGGATGAGTATGCAGAACGTCTCATGTTTG
CCCTCAACACGGCTCACGATCGAGTACGCGGCGACACGCCTTTCTATCTGGCGCGTGGATGGGACCCAAGATCAGCGCTGGAGGCGATGATCCCATTAGG
ATCAACGCGGCGCCGAGATCGCGACCCCCAAAGGTGGCGATACCATATTCAGAAGCATTACCAGCAGGCGCGTGAGCAAGTGAACGAGTACCTACGCAAA
GCTATCCAGACCAGGGCGGAACATCATAATGACTCGGTGCGTCCGCACGAGATCGAAGTCGGCAACCAAGTCTGGCTGCATCTGGATAGGGTGAAGGAAG
GCTACGCATGGAAGCTAGCGCACATGTGGCACGGACTTTTTAGAGTGGttgagaagatcgacgaacACGCCATGCGATTGGAGATCGCTGGCATTGCGTA
CAACTTATTCCCAGTGATCCGCGTGTCGAAGCTTAAGCCCGTACGAGACTTCCTCGACCGTCCGCGTCTTCGACTAGCCACCCAAGAGCAAGAATGATTC
GATTTTGATGAGGCCTTGTTGCCTGAAGATAGCTGGGAAACCGAACTAGGTGAAGACGAGTACGAGGTAGAACGCATCACTGAAATGCAATCGGGACGAC
GAACACGTTACGGACGAGCGCTACGAGAATTTCTGGTACACTGGAAGGGCTACCCTGAACCAACATGGGTGGATGAAGCCGATCTCAGCTGTGGAGCTAT
ATTGCACGACTACCTGCGCGAACAGGCCAACCAGAACCGGTTTGAGGCCATGCAGTCGCACGAGGAGTAG