Transcript Name :
Phyta_totarag14244
Orientation:
(-)
Number of Exons:
9
Description :
Eukaryotic/viral aspartic protease, active site
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Peptidase A2A, retrovirus, catalytic8.61PS50175
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-861
*** None ***
*** None ***
TypeScore
nuclear435
GO
Biological ProcessGO IDPrediction Method
aspartic-type endopeptidase activityGO:0004190IEA
proteolysisGO:0006508IEA
*** None ***
*** None ***
Sequence
        3916 bases(100 bases per row)
ATGCAGCTCACTGCAGCGCCGCCCCGTGCAGAACCGCCAGTTGCCAAGGAAGAAGCCATTCCCCaggcgctggaagacgccAACGTCCGACTGATGCAGT
CGACGATGATGCGGGTGGTCAACGCCGAGGCACCCCGTGCACAGCCAGAACCGACAGTGGCACCCATGTCGGCagacgccgacgtggccatGGAGTTGGT
GAGTTCACACTCCACGTCGCGATCTCCGCGTCTTCGACGCAACCTAGACGAGGGCCCGGACGATCTGTTCGACCTGGATCCCGGTACGCCCGGGAACGCA
GCCACTATCTCGGCCACGACCGCCGGCACCGCTGGAGTCGCTGTCACCCGCGTACGCCTCTCCGCGTTCTCGGAGTTGAAAAGGTTCCACGGTAGAGACT
CCAGCGAAGAGAAAACCCGGACCTGGCTCAACCGCGTGAAGTCCGCGCCGTGACGGCATGACCGGTGACGAAGTGTGCGCCATGTTCAGTGACTTGATGA
CCGGACCCGCGCGCCAATGGTACCTTCAGCTGGGCCGAGATGTCACGAAGTCGTGGACAGATCTGACGGAGCAATTCCACATCCAGTACTGCGGCAAGGG
CGTGTCTATGGTGAGTCGGTATTACCATGCCAACAAGCATCCCGATGAGACTCCGTTGGAGTACCTGTATCGACTCAACGTCGCGGGAATGCGGGCCAAG
ATCCACTACGCTGATGGTACAAAGGAGGAGAAACGAGAGCACGTGGAGTTATTCATCAACATCCTCGGTtcacaagaacaagaactgGCCTCTCGACTCA
CCTTGATGGAAGTGACGGATATCGTTGCGCTGGAGAAAAAGCTACGCGCTCGGCAGCGTGGACTCGCccaccagaagaagacctTGTTGGATCTAGCAAG
TCCCGTCAGAAGGCGTCGACACCGACGCCGCTGACACGCGCGGTTCACGCGGTCCAAGTCACGTCGGACGGGTACGACTCGGGGCGCGATGACCGCGGCT
ACGACGATCAGATGTACGATCAAGATcgagacgacgaagagcggGCCAAGCTGTTTGTGACGGGTCAAGTGCTGCCGGACAAGAACGCACGTCGTAACGT
TGACACGGATGACTTGGGGCGAGACAAGCCGCGATGCCGCCATTGCAAGTCGTACCGTCACTCAGACGGAGATTGCTGGAGCATATTGACCTGTCAGAAG
TGCAGTGACCATCACCCAACCGACCGATGCCTACGTGCGTGTCGAGCTAGTGGGAATGTGCACGAAGCCGGAGAATGATCCATGGAGGAATTCTTCAACC
AGCCTCGCCAGTTGTATGACCCGCAGAAGCATGCTGGAATGCTGCCACCGGCGGCTGAAAAGATGTTGTGCTAGATCGCTCGTTGGCTTGGAACCAGAAC
GAGACGAGTGACCTGTTTCTGTCTATGCATATGTGACCAAGAAGTCGCAAAAGGTGGTTAGTGAAGACTCGAATACCCCGATCGATAATACATCTGAATC
CAACCTGCAACGTGCCTCGCGAGAACGGGTTTCCCGAGTCTTGGACATTCGACTCCCGGACGAGCACGCGCGAGAGCCGCCGCTGGACGGGATCGCCCTG
CAGCCTGGGGAACGACGCGGATACTGGAAGTACTACGCGCCGGACAGATGGTATCCACAGGTCAAGACCTACGGGAAGTTGAACAACCGTCGTGCtacgt
tgctgctcgataCAGGTGCCGAGGTGTCCATACTGGACATCACCTTTGCTCGTGAGGTAGGCCGCCTGATCGACACGGACATAACGCAGAATTGTGTAGG
AATCCGCGACGAAACGTACTACACGGTGGAGAAGACACTGATCAAAATTACCTTAGCGGGGAACTTGGTCTACTTCCTGGCTGGACATTTGGGTCGGAGA
CCTGGTGGGCCAGCACGCGATCTTGGGCATGAACTTCACGGTGCCTGCCCGGCGAGGTGCAGATCCAGATGATCGGAAAAAGACCGCTGTACGGTTCGAA
GATACACCCGATCACTCTGACGTcgctcgagaagatcgacccGGGGCGAACGCACGACGTTCAACTACGGCCAGACCGGAATGCTCCGCGACTATGGGTT
ACACGAGGAAAGGCATGGGTGAGCACTTTcatgaagagcaagatcGGGCGGCGAACGTACCTGCGGGTGACCAATATCGACAAGCCAATAACGCTCGACG
CCCACATGACGCTGGGCTGGTGGACGCCCGTCGACGCCCTTCGGCTTCGTACAAGTTGAGTCGCGACGCTATCAAGAGTGGCAGAACCTCGCGTACGGTG
CCACCTGCGACGCGGACGATGACTGGACGTCCGTCGAAACCGACGGACCGATGACCGAGCGCCCGACATATGAAATTCCCCGAGGAATCATGCGTCGAGG
CGAAAGGAAGACGGAAGACCAAGTAGAGCGCCAGCGAAGTCGTCCCCAGCGGTCGCTGCAGTTGCGGTGGTTGCGCGGGTGACGGCTGCAGAACCGGCGA
ATCAGATGCCAGTGGATACCGCAGAGGATGGGCCAGACGAGTCGTTGAGGCTGACGACGCTGTACTCTTTCACGAAGGTTCGGACCTCTTTGCAGAAGAA
TTGGAGGGGGAAATGGCCGTTCTGCCAGATCTCACTCTGATCGCTGAAGTGAAGATCGAAGATCTCAAAGTCGGAAGTCCAACCGGGGTAACACCAGAGG
TGGCTGCGAAGGAAGAAGACTGGCTGCGCCAGATCATTTGGAAGCGACGCAAATGGCCGATCGGGAAGGGCAATGCATCACCGTCCGCGGCCATGGGGGT
CGTCTGCGAcatcgatgtcgtcgacgctAAACCGATCGCGCAACGCGTCCGTAAGCTCCCACATcagttcaaggagaaggtCTCCGACCTGTTCAAATGG
ATCCTCAGCGCGGGCATGATCCGATTGTCGACTTCTCCGTGGTTATCGCCCATCGTCGTGATTGTGAAGAAGAATGGGGTCGACATCCGGTTCTGCATTG
CCTACAGACTGGTAAACGGACTGACGCAGCTGATGGTGTATCCGATGCCGCTCGTCAACGACTTGCTGGAAGACTTGGAAAGTACCTCTGGTACTGCTCC
CTCGACATGGCCAGCGGGTTCTGGGTAGTCCCCATGACAGATCGGGCCCGACTAATCTCGGCGTTCATCACCCCGTTTGGGCTGTTCGAATGGCTGCGGA
TGTCGTTCAGACTGTGCAACGCGACAGAGCGACAATACGCTCTACGGCTTCTGGAACTTGATTACAGATCGAAATACACGGGACGTCTTCGACGGAGGAA
AGCCGGAACTTCCGGGGATCCACTCCATTCTAGACCGTCGATCGTACATCGATGATATTTTGATTGGTGGCACGTCATGGGACGACTTGTTCAAGAAGGT
GGAACGCCTGCTGGACGTCTGCGAGCAATGACACTTGTCCATCAGTGTGGAGAAGAGTACGTGGGGAATGTATCAGGTTAACTACCTGGGTCACAAGGTG
TCGGAGCACGGGTTGGAAGAGAAGCCGAAGAATCTGGAGTCGCTCACGAGCTTGGAATTCCCGCGTACACTCAAAGGCTTGCAGTCTTTCTTGGGCAGTC
TCAACTACTACCACCGGTTCTCGTTGACTTCACGATCTACGCAACCACGTTGTACTCGCTCACAGAGACCGACTTCGACGAATACGTCGCGAACCCGGAA
ATCCGCGAACAAGAAAAGTGGAGACACGCATCACGTGCGTTCGAGGCCCTCAAGCCCAAGATCGCCGAGACCCCGATGTTGAAGCACTACGACTTAGCCC
GAGAGCCCGTCGTAATCGTGTACGCCAGCGACTGGGCGATCTCGGCTGTCCTCACCCCAAGCTCACGACGGCGTGTACATGCTGGTGAAATTCACCAGTC
GCCCGTTGAAGCCTAA