Transcript Name :
Phyta_totarag13972
Orientation:
(-)
Number of Exons:
8
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-544
NN-scoreoddsWeighted Score
0.6013.260.007
*** None ***
TypeScore
nuclear435
GO
*** None ***
*** None ***
*** None ***
Sequence
        5279 bases(100 bases per row)
ATGAAGCGACTGTTCCGAGCGTTCCCGAAGGTTGTGCTGGTCGACACCACGCATGGCATCAACGCCAACCAGCCCAAGTTGTTCAGTTTTGCTGTAACGG
ACTTCTTCGGCAAGGTCAGTGAACTTACAGAATATTATACCGAACATTTACAGAGGTCTTACATATTGATGACTGTATGACGATAAGGCAAGTGTGTACA
GCATACACTCGTCAAGGCTGAGACACAGGACAACTTGCGACTAGCAGTTGAGTGCTTTCAGAGTAACAACCCAACCTGGAGCAAGATAAAGGTGTTTGTG
ACGGACAAAGCCTTCCGTGAGAAAGCAGTTCTTGCAGACTGTTTCCCGGACTCCAGACAGCTGCTGTGTACGTTTCATGTGGTGACCTGACTTGAAAAGC
AAGCCGGACGCCTGTCGACAGGACCCATAGAACACAAGGGCAAGTTGAATGCTACGCTTTCGTCGCTTGTCATGGCAACGAGCAAGACTCAATACGAGCA
GGGAAAAGCGTCCCTACTGCAATTGCTAGACGTAAATGAAGACCGCAATCTGTATCGAACATTCATCAACAATTGGGGTGGAAGTAGAGCCGAATGGGCT
CTGTATGAACGCGGGCACGTTCCCTACTTGGGCAATCATACAAACAACCGTCTGGAATCGAAGTGGGGGGAAATCAAACAGGTCGTCAACAAAGATGTCT
CCATCGACGATTTGATCTCGGCACTGATCTTATTGCAAGAGGTTGCTGAATATGACTACTTGCGTGAATATCACAGAGTTGAATCATGCCCACAGCGTGA
TGAGAATTTCGAACTGGCTGTGCTTGCAATGATTTTGAGTCCGTTCGCGTTTGATCTCATTGCGGCCGAGCTCAACTACACTACTGGTGGGCGTGCTGAC
TATGCAGTGCACACTGAGAGAGGGGTCGCCACTTTGAAAAGCCATGGAGCCGGTATACAACACAGTATCAACACAAAGGTGAGGTTTCCGGTATGAAGTT
GAGCATCAGTTCGGTACCTAACGTTGTTATACTAACAATgtgactgctgctgtagctgtacTCTTGCAATTGCACATTTAGGCAGACATACCTGACCCCA
TACCGCCATATAATGTACTGGAGCCTGCAAAATCTGAGTGAAACAGTGCTGCCTCCTTACAATACCATCGCTCAGCGCTGGATGAGAGAGTGTCCTGTCA
ACGGCATTGCTGTAGGAGATGTTGGTGACGGGGACGTGAGTCTTCAATCTATTCAAAAGTTGCCTCATCAGAAGGCGTTGCAAGGAGACGACAAGTACGT
CAAGGCAAGGAACAGGTGGAGATTATTGTGTCAGTATTGACGGTGCAAAACACACCCATGTTTAAAGCAGCGTTGGGGTGTCTGGATAGATTGGCGAAAG
CACTGCATGAGGGGTGGTTCGCGGCGTTTGCAGCGGGTTTCTCGCCTCGACAATTGGCTGTTGTCAATTTTGAGTCAGCTACTGCAAATGCTACTAGCGG
AAAGAACCCAGCGTCAAAAGCAAATGGGCCAAGTTAGCAGGAAAACAGGCtcggaagcagcaggcacCTGAAGTAACCATTATGCTACACGGGGTTTCCA
AGACATAAGAGCAACAACCCTCAGAAGAAAAAAGGAACGAGCACTCCGTACAGAGAGCAATTTTAGATTCACATCACCTCCAATGGCACCAGGACTCTca
cacaaacagcaacgacaagtCAATCGCGCCAACAAGATTCGTGCGTCTCGGACAGAGGCTAAAAAAAcatgtcgaagaagaaaacccCGTTACTTTCGAA
GAAATACGGACGCTACTAGCCGATCAGTACTCGTGGTCAAACGTGAGATCATGTatggaagagctgaagctgaagacatgCGATATGCAAGGGGCTGTGA
AGGTTCGACTGCTACAGCCCGGAGAGGTCATACCAATTGTCACCAGCATGCTCAACCTAGAGGAgattgaagaagcaaaaACCAGCATACCGTACGACAT
TGAAGAGGACATAACGTACGTGGCATGTTGGAAAGGGTTTGGCTGCATCACACACGCCCAGCGTGTGATTATGGAGCGGATCCTCGCAGTCAAGAAGACT
TTGCGTGGTGTTGGCTTTACACTCGACTGGATTGAAGCCGTGACATGGAACGAAGCTGATCTTCATGTAGTAAAGGATCTATTCGGTGTTAAACCGATGC
TGTCCAAGGTAAGTTTGTGCACAACAGACTTTGTTACCGAAATGGTTACAGAAAGCAATACCAAAAAGTGCTACAAAGACACTTCCGAAAGTGCTATAGA
ACATGTTACCGAAATCTGACTACTCTGTTTGTGCAATACAGGCAGAGCGCAAGGGCGCCGTAATCAGCATGCCGTTGGATATGAAATACCGGGACACGGA
GGCAACGACTGGGGCCAGTCTACTAGCGTAACGCGAAGATATGTGGCTGAACTTAGGCTGCATGATCACCGGGATGCTGTATCTGCAAGATGCCTACCCG
GACGTTAGTGTGGTGAACCCTCGTTTTATCAGCGCAAGACACCAGCCGACCAGATCAAGGTGGCGTCCTCTTTCAAGCCATTTGAGTCGTCCAAGAGGCA
TATCATCGGAGTGCTTAATGTAAGGTGCACACTGGGTCGCCTATCGTATCAACTGCGACACTCACATCTGCCACACATTCGACCCACTACAAGGAAGTGT
CAAGAAGGTGACCAACGCTCTTCGAGAAATTGTCGAGCCTCTGCTGCACATGAAGGTCGGTTTGTTCTATGAGGCTGTGAAGTGGTGTAACCAACGAGAT
GGGAGTTCGTGTGGAGTTTAAGTGACTTAGGCCCTCGTCCAAGTGGAGACCGCGTTCTGAGACTAGCCCTTTCTATCGTTTCTATTGGCTAATATTCCAc
tggtacactgtaccagTTTGCCTTTGTCGTGGCCCATAACACCAGTTCCCATAACACCAGCATGAGGTGTGCCAGCCAGATAATGTTTGTACTAGCGATG
GACAGAGAAGCTTCCGTAATTTGTGCCGGTTGCGATTACGTGTGTATCTGCTGTAATCGTGTCGCTTGCTGACCGGCGTAGCCTTCGAGCGCCATCAACG
CGCACGTCGACGTTCCGCTCGACAACATTCGAGCAAGCTATTCAGGCTAGTCAAACGGACTGGTACAAGAAAAGCTGTGGTGCAATAAGAGCTCTTTCCT
TTACATCTATCAAGCTACCTATAATGCAATAAGTCACCATCCCGCCCCCAACGCCAATACAAGCTTATTAAGTGCGTCGCGCTGACGATGCTCTAGTTAG
CGCAAGGCAGCACCATGGACGCGGCTGCTACAATGCTGGGCATCTCCAGTTCGCGCTCAGTCAAGTACATCAACTACACATTGGAGGTGCTCAGCACCAC
GTCTCGAAGGCTAGTGGTGATGCCATCAAcagaggagctggtggacatTGAAGCCGGCTTCTTTTCCGTCACCGGTTTTCCAGTTGTCGTCAGCACGATC
ACTGGAACGCTCATCAAAATTCCCCGGCCTCACGACTTCGACGGCTGGTACTGCCGAGAAATTTTCCCGGCAGTAgatgtaacggggttacatgtacaag
tggCTATATTACGTGTAAGCTAccagaagtggcttctgaTAGAAGTTAGAAGGCCTCCTAGCTTCctgtgaggcacaccaatgactacatttaggcggac
gatTGGTCCGCATATATTTAGGGATTTCATTAGTAGAAaacagcatctttctaccaattagaatcatagtATTCTGCTGACCACCTCTCGACAGACCTCT
ATAACATAGTATCACATTTAGAAAGCAAACGCAGCGAATAAAACAAATAAATACTGTACACTGTTCTCAATTTCACATAAAATGTTAATTATCGTATTTA
ATCTAGccttaattatacttgcagggcgcaagtataataaagttaagtcaaagaaatctgcgcttcctcatacccgtgtgcacacgtgtaagctatAGTA
GTGagctaagtaggcccattacactACGTGCTTCAGCTCGTACGAAGTTTTTAAAGAGGAGCTCAGGCGAGCATTTAAACGTCCTCAAAGCAAGCTCCGA
TTGAGGGCAGAGCTCCTAGATCTGCAACAGGGTAAGCAGGACGTTCACACTTACGCCCACAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCAA
TTGACAAGGCGATCAAGatcgtcacgttcatgaaggGCTTGAAGGATACGAGTGAAGACTTATCTCTTCCGAGAGTACCCGAATACCCTCGAAGCTGCGA
TCACGTTCGCAAGGCAGGAAGTGTTTAGCCTGCGACAGGCTAAACTGCATGTGAATGTACCAAGGATGCCACGTCCGGTGGTACTCACGGGAGGTCTGGA
GCTAATGGACCTCTCGAATTCGACGACTGTCAGTCACCCACAGCATCGTGGAGCTGACGTACGATACATCCGCTGTGGACGCATCGGTCATTTTGCACGC
GAGTGGACAGCACCTATGCACGAGCAAAGAGGCCAACATCGCGATGTCGGGTATCGCTGCGATCAACAAAAAAACACGTGGAAGCAGTAGGTGCGGGGTG
TCCAACTGGTGAAGTGGTCACGCGTGTCGAATTGGACACGCGTTATTGCAGGCCGCATCCCCCAGTGAGAGACAATCTCACTGCAAGAAGCGAGATGACA
AGCCAAACCttgtcatcctggacgtgacGTCGAAGAGAGCGGACTCTCTTCGTGCGTTGGTAGATTCCGGTGCGTCGAACAGCTTTGTTCGACNCTTCGG
TTGCGACAGCAAGCGATGGCCCTGTCAGCGCAACACATGCACCGCGAGGTGCGTGACCTTCCACTGGAGACAGCGCTGAACGCTGCTGTCTCGACGCGCA
GGGCTCGAATGAGGAAAACTGCGACGACTTCGAAAGGCGTTGGAAGTGAATGTGTGTCGGTTCTGGGAAGCAACACAGATTTAAAGGATGAATCCGCCAC
AAAGGAACACTGTGATGTCGACGAGTCCACTCTCGGAGCTGACGCAAGTCTGATTAGATCAGACTCGGCAGGACATTCCGACGAAAGGCGTCGATGCGAC
GAAGGCACATCAGCACCGGGAGTTGACGCTGTGAGCACTGCGTACGGTTGCAAACGTCCAGCATTGGGAAAGCTTGCAGGCTCTCGTGCAGCcgggctgc
acgaagaagaaccaaTTGCGCATCAAGCCGGGCTTGATGACGCGCGCCCGCGGATACAATCCGCCGGCGACAACAACAC