Transcript Name :
Phyta_totarag13294
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Integrase, catalytic core9.307PS50994
Chromo domain/shadow11.996PS50013
HmmSmart predictionP-Valprediction_id
Chromo domain/shadow3.8SM00298
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Chromo domain/shadowIPR000953
*** None ***
InsideOutsideTMhelix
1-643
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        2480 bases(100 bases per row)
ATGCTGGAGATTCATCGGTCCACGAagggagaagaagagatACTGGGGGCGTTAGCCGCGAGCATCACACCCAGAGCTTTCGTGGATACCGTCCTGGAAG
AGATCGCACCGCGCAAGCGTCCGTCGCGAATTGCCGTCATCCCAATCCCGACGATCACACcggaggaagagctccacGTGATGAGTTTCAATGGATCTGC
CAAAGCCAAGCGAGAATGTGGAGCGTTTAGCGCGATCATCTGGAAGCTACCAGGATAGGAGATCGTCCGTGCTGCGTCAGGATACGCGGTGGATCGTACG
GTCAACGAGGCGGAATACCAAGGTATGCTGCTCGGATGTTCGCTCCTCGAAGGGTTGAACGTCTCGAGGCTGATCATCTGCGGAGACTCAAATCTCGCCA
CCCGACAGATGCGAGAAGAGATGGGCTGCAAGTCACCAGGCCTGAAGCTGCTCCGGCAGCGAGTCCGGAACGCGCTACGAGAATGGCCCCGTTACGACTT
CTTCCATGTACGTCGAGATTAGAACGCGAGTGCCGATATGCTGGCTGGAAAGGCGTTGCAACGTCAAGGCGGCATAGAGGTCCGCAGCCCGGAGGAAATC
CAAGATCTGAAGACGTTGAATCGCCTCGGAGAGATCGTCCGATCTAGAAGACCCAATCCAGAAACGCCCTATTTAAGCCAGTCGACGGTAGATCGTACCG
ACGCGAAACACGGGGCGGCACAAGTGCAAGCAGTAACCACCCGGTCTGTTGCAGCGCGGACCCCGTCGACCCCGGTTAGGATACCGGAAGTCCTTCAAGA
GCTGGTCGTACAGCGACTCAGGCTAGATCGCATCCGGATTGCCCAAGATGAGGAGCTGTGGATCGCGAATCTCAAGAAGTATTTGAACGGCGATATTGGA
GAGCCCTCCAGACGGGAGgcgaagaactgcagcaagattGCCCACCAAtatgaagaaggtgaaggtgaccTACTGTATTACCACGTGTGGGGAGACGAGT
CGGCTGAAGAACGCGACACGATCATGAAGTTGGTGCTTCACGGAGCGTCCCAGAGACGCTCCGTGAGGACGTCCTGCTCCACTATTACGCGAGCCTGGAA
GGTGGCCATCAAGGAATTGGCCGGACGTATCAACGACTGCGACGCCATTTCCATTGGCCCGGGATTTTCAGGAGCGTACAACGTTTCGCGGGCGAATGCA
CGGACTGCGAAACCGGAAAGGGGAGACCGACAATTCAAGGCGACTCGCCGGGCAACATCGTGGCGACGTATCCGTTCCAAGTCGTGGCCATGGACCACAT
CCCGTCTTTGCCAGCGTCATACAAGGGCAAcaccgagctgctcgtgtggGTCGACCTGTTTACAGGCTTCGTTATCGTGAAGGCGAATACGTCACGGACC
GCGCAGGCAGTTGCGGAAGCATACGAAGAGGCCGTCTTCAGACGATTCGGCGCGAGCTAAGCGATTCGACACGACCGTGAGCCGGGCTTCATGTCCGATT
TCTTCAAGGCGTTCAGCAAACTCATGGACCAGAGGCAGCGAGCCACGCTCGCATATAGGCCCCAAGCCAACGGCGCTGCAGAACGTATGGTGCAAACGAT
CACGAGGGCCATTAAGATGTACATCGCGGACATCAATCAGCGAGACTGGGATGAGTATGCGGAGAGACTTACCTTCGCGCTCAACACGGCACACGATCGT
ACGAGAAACGAGGCCCCGTTTTATCTCGTGCACGGTTGGGATCCGCGCACTACGCTGGAAGCGTCACTGGCTATCGGTAATACGTCACATCGCGACGTGG
AGGCCAAGCGTTGGAGATTACGCATCCAACGGCACTACAAGATTGCGCGAGCACAAACGTTAGATTTAGTCCAAGACACAGTCGACGCGAGGGCCCGACT
CCAGAACGAGATCGCAACGGAACACCCGATCGAAGCCGGCTCACGAGTGTGGCTCTACCTGGATCGCATGAAACCGGGGTATGCTCGCAAGCTGGCACAC
CTGTGGCACGGCCCGTTCCGAGTCGCTGAGATGGTGAACACGTATGCCGCGCGTCTCGAGATGAACAGCACGTcgtaccagttgtacccgATTGTACATA
TCTCCAAGCTGAAGGCCGTCCGGAAGTTCCCGACGCGTCCTGAAGCGCGACTGACGGTGGCTGCTGACGCACAATTCGATTTTTACGAAGAGATCCTCCC
GGAGGATAGCTGGGAAGCGGGGGAGTTAGGAGAGGACGTGTTCGAGGTCGAACGGATACTGGACGTGCGAGATGGACAGGCCACCCGATACGGTCGGACG
CGACGTGAATTTGAAGTCAAATGGAAAGGAACTCATGAGACGACATGGGTCGATGAGTTGGATCTCAATTACGGAGGACTGCTGTATGATTTCTTACGAC
AGCGTACTGGGCAGAACCGGTTACAAGTCATGCAGTCGCACGAAAACGCAGAAATGACCGGGCATGATCCTGGTGGGTGA