Transcript Name :
Phyta_totarag12633
Orientation:
(-)
Number of Exons:
7
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Reverse transcriptase9.409PS50878
Integrase, catalytic core8.777PS50994
Chromo domain/shadow11.526PS50013
HmmSmart predictionP-Valprediction_id
Chromo domain/shadow3SM00298
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Chromo domain/shadowIPR000953
*** None ***
InsideOutsideTMhelix
1-1931
*** None ***
*** None ***
TypeScore
nuclear478
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
RNA-dependent DNA replicationGO:0006278IEA
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        7464 bases(100 bases per row)
atgaaggcccCGGACTCCGATATCGAAGATCGCGATGATCCTGCGCCAGTCTGGACCGATAAATCGCTGGAAGACGCGTACTACAGGAAGGACCTTAACG
ATTTCCTGATGCAGAACCCCGTGATGATGATCCTTCGTCCGAAGTTCCTCGGTGATCTCAAGGGCCCCGCGTCGGAACTGGCCGCCGGATCAAACAAACT
GGAAGCAGTGAAGGCGCTGCTCCAACTTCTGGAAGAATCGGGGATCGTCGTCGGTGCTTTTGAAGCCGAGGATCTCTTTGATCTTAAGCTATGCGTGATT
AAGCATGCGCTCCAAACGCTCTTcacgacgctgaagcagatggTTGGTAGGCTTAGCCAGCCACCCAATAAGATCGCGAGATCGAAACCAGCACTGGGAA
TCGCGACATCACACCCGACGCTGACTCCGGATGATCAGACAGGAACGTCATCGCATTACGAATCAGCAACCGAAGAAGTGGACACGGTCAGCGCAGGCGA
CCCACCACGAATGACACTGGGACCGTCCGGCGCAGCCATGTTGCGAGATCGAGCTCTACGCGCCGAGCAAGCCTCTGAAGCTTCTATCCACGAGACGAag
attgcagcagcaagcccGACGAGCCACTCGCCTGAGAGGCTGGAGTCATATTTCCAAGCGGCGATGGGACGCTTTCTGAAAGAGCAACAGTCGCCTCCCA
ACCCTCGAAGTACAAGGccgactggagatcaagatgtGGAAATGGAGTCGGTTGGGTCACCAGACCACCACTCCTCGCCATGGGAGTATGATCCCAacga
tcttgatcttgacaCGACCGCACCAGCAGTAGTGGCCTCGACGGCGACTGCCGGAAAACCGACACCTGCTCCTCGCATCCGTGTATCGGCGATGTTGGAG
CCGAAGGCGTTCGCCGAAAAAAATGCTGACGAAGATCGAGCTCGATCTTGGCTCGGCAAGGTGAAATCAGCATTTATCCGAGATCAAGCACCCGATGAAG
AGAAGTGCTTGGTTTTCGGCGATCTTCTCACCGAACCAGCCCGAAACTGGTACCGACAACAAAGTCGCACGACGCGCAGCACTTGGAAGGACTTgctcca
gagcttccagAAGCAGTACTGTGGTCATGGTGTATCTGTTGCGAGACAGTATTACCACGCCAAGAAACGTTCGGATGAGACACCTCTGGAGTACTTGCAT
CGTCTCAATGTGGCTGGCCTACGCACGCGGCTCCAGGTCAGAGATGGATCTCCGGAAGTCCGCCGCGAGCATGTCGATCACTTCATCGAGACTCTCGATG
ACCGCGATCTGGCTGACCacctggcgctgctgcggatTCCAGACGCTGATACCCTGGAAGATACACTGCGATCTCGACAACGTGCGAAGGCGCGGCAGAC
CAAGACGGTCTATGGATCAATCAAATCTAGATCAAAGACCCCAGGTGCAGCCGGCCCCTCGGCCACTAGAGCTGTCCGAGCGATCCACGTGgccaacgac
agcagcgaatCTGAAGCTGTGTTAAGCGGGTCCGATGGCGAAGCCGGATTGCGCAAGGTATACTTGGCAGCGACTGGAGGTCGTGGAGAGCCGCAAGATC
GGGGACCGCCGGATCAAGATCGTGAGCGTTCAAGTTACGCGACTCGTGATCGCCACCCGAGATCGACAGATGAAGGGACGCCACCCAAACGCTGTTTTCA
CTGCGGATCGCGCAAACACACCGACCTTGGGTGCTGGGGACGCTTGACCTGCGAGAAGTGCGGCAAGAGAGGGCATCCGTCTgagcgctgcttcttcgtg
tgcaAGGCGTGCGGGAAATCCACGATGCCGACAAGTGCCCGATGGAAGAGTTTTACAACTTGATCCGTCAGTGGTTCAACCCCACCAAGCACGCAGGCAT
GCTGCCGGAAACGGCCGAAAAGATGTTAAACTAGGACGCTCGCCGGTTTTGAACCCGGTACGAGACGAGCGTTCTAGATATTGTGTCTATGCATATGTCG
AAAAATAAGAGGAGTCAACAGTTAGCAAGCTGATGAACCCGAGCGACAATACATGTGATCTTCATGGAAAACCTACCCTCCGCCGTATCAAGTCTTCACA
AGATCGATGAATATTCAAGATCGAAGGTGATGATGGCTTTGGACATTTTGCCAGGAGGGTCGCGTGGTTACTGGAAGTACCACGTGCCTGACAAGAAGTT
CAAACAAGCGAAAGCCATGGGGAAGATCAACAACGAAAAAGCAACCATGCTGTTTGACAGTGGCGCCGAGGTGTCTATCATCGACACCGCATTTGGTCGT
AAGGTTGGGTGCTACATTGACGAAAGTCAGACATTGGAGCGTGAAGGTGTTGGGAAAACTCCATATATTGCGGATGGGCGTACCAGACTTAAGATCACTC
TCGCTGGATCATTGATCTACTTTTTCGATGCGTGGGTGGGCCCACCTACCAGTGGACAAGACGTAATTATCGGTATGGACTTCATGGCCCCCGCTGGAAT
TCGCCTTGATCTCGCTGACGGCACGATTTGTATTCCCGATGAAGTGCGTATCCAACTGTCCGGCAGGCGTCCGCTCTATGGGGATCGCGTTAAGCCGGTG
ATCTTGAGGGAAGCTCTCTACATCGAGGTCGGGAGATCGTTGGAAGTGAAGCTACATCCGAACAAAACCGAGCGACAGAAGGTGTGGTTGACCCGTGGGG
ACCGATGTATGCCTACACTAACGACTTGCCCAGACAGGACGCTCTATCTGGAGTTGACAAACGTGAGCAGTCGCAAGTTAGTGCTAGGTCAGAGCACGCA
TATCGGGATGTGGCTGGCTGGAGATCGCGTACCACGTTTACCGGGATACGCCTCCGTAGGGTCGCGGAAGTACGCCGAATAGCAGAACCTCGCGTACCAG
GCGACcaccgacgaagatgacgacctccaagctgctgcagaacccCAAGGGCCCGCCGTCGAACGACCGCAGTACAAGGCACCCACGGCGGTCTTGCCTC
GGCCGCTGAGCCAGCCGGTGCTGGCAGTGGTGACTGCAGAGAGCGATGAGGAGAGGATCGACGTCAAATGCGACCGACGAGCTCTGCGAACGGACATCCC
GAGGGTGGAAGAAAACTGTCGAGATTCCGACCGGTTGCCAGCTGAGAGAGGGCGCGTCAACTCTGATGAGTGTACCAAGAATCCAGTCGGCGGTGCAGAA
AAGGTGATGCATACTGCCGATTGCAGAGATCAAGATGCGGATTTACCGGATATCGGAAAGGCAGAAGGATTGCGGCAGGACTGTGACTCGTCGCCAGTTA
AGAGAAGGGACGCATATATGTCAGGTGAGGATGTGTCGCACGTTGACAGAGGCGACAACGCAAAAGATCTAGTGACCCCAGATCATGATCTCGAGAAGCG
TAAACATACACCCACCAAGGATTACTCGGGGAGTAAACATGCACCCGCGACGGATTACGGGACATGCACACATTCAAGGCCGGTGTATTCTGTCGAAGAT
GAGCAAGTATGCTTCAAGGAAGGAAGGGAGTTGTTCactgaagacgtcgaaggGCAGATGGCAGTGTTACCAGAAATTACGGCAATGACAGAGGAAGCCA
AGATAGAAGACATTCAGGTAGGTGATCTCAGCGACAACACGCCGGAGGAGATTGAACGACTACGACAGATTATCTGGCGTCGCCGACATCTCTTAATTGG
GAAAGGTAACGCCTTACCGCCAGCTGCGAAAGGAGCGATATGCGACATAGACGTGGAATGTGCTAAACCCGTCTCCCAGCGGGTGCGAAAAGTCGTCCTG
CAGTTCCGCGAAAAATTGTTTCAGCTGATCAAGGGCCTGCTGTCTGCGGAGATCACCCGACACTCAACTTCACCCTGGGTCTCACCGATTGTGATCATCA
TCAAGATGAGCGGAATTGACATCAGGATATGCATCGATTATCGGTTGGTCAACAGCCTGACGCGACTGATGGTGTACCCCATGCCGCTGATCATCGATCT
GCTCGACGATCTCGACAAGATGTTTTGGTACTGTTCACTAGACATGGCCAGTGGGTTTTGGGTCGTGTCTATGACGGATCGGGCCCGCGCGACCTCAGCG
TTCATTACTCCGTTTGGCCTGTTTGAGTGGAACCGAATGGCCTTCGGATTGAAGAACGCGCCGCAGATCTACCAGAGACTGTTGGATAACGCTCTGTACG
GCTTCCTCAAGATTACGAACGACCCTGGCCGTCCTCGCCAGATCGACCTGTTCAAGGAGGGAGTGTCAGACACGGAGAAGGAATCGTCTGTTATCGGTCG
CCGATCTTATATCGACGATATCCTGGTGACGTCCAATACGTGGGATAAATTATGTGCCAAGGtcgacaagttgctggacgCGTGCGATCAGTGGAATTTG
TCGATCAGCGTCGCCAAGAGCTTTTGGGGCTTGCGAAAAGTGGACTACCTCGGACATCAAATACCGATCGAGGGTTTGGAGGCTCACCCGAAGGACCTGT
CGTCGTTGGTTGATCTACCGTTCCCCACAACATTGAGATCGATGCAGTCTTTCTTGGGCAGCCTCAACTATTACAGCCGCTTCATTGAAGATCTAGCGAT
CGACGCGTCGGTCTTATATGAACTCCGGGAGGCCGACTTTTACGAGATCTCGAGGAAATCCAAGCGTGACCTGAAGGCGCCCAGGCGCGATCTGGGAAAC
AAAGACGAAGCTCAACCCAACGAAGAGGGAAATGGGACCGGGTGGGTGTGGCAATTGCTACCCTGAAGAATATAATTGCTACAGCACCTATCCTTCAACA
CTTCGACCCACCGACGACCGGTGATCATAGTCTACGCGAGTAAGTGGGCGATCTCGGCAGCTTTGGTGCAGGAGCATGACGGGATATACAAGCCGGTGAC
ATTTACCAGTCGCACGTTGAAGCCTAACGAGATCAATTACGGTATCGTGAACAAAGaagtgctggcgctgctcagGATGCTGAATTCATGTTACACCCAA
CTGGTGACCCGACCAATCAAGGTGTTAACTCGGCATTCCACGTTAGCCTGGCTGGTTCAATCATCGGGCTTGCAGGGATGCTTGGGCAGGTGGGCCGCAC
TTCTTTCTAGCTGGACGTTGGAGATCGTCAAGTGCACGAAGGGCGAGGATGAAATCTTGGGTGTGGTAGCGGCAAGCATCACTCCccgagaagaagttga
cgcgATCTTGACGGCGATCGCACCACGAAAGGAACCTCGTCAAGTGATCTCGATGCCCCCTCCCACGGTGGAACCCGAAGCAAAGCTGTTTGTAGTAAGT
TTGGACGGATCGGCACGTGCGAagcgaggtggaggagtgTATGGAGCAATTGTGTGGTGTCTACCAGAATGGACAGTGATCTTGGCCACGTCTGAGTACA
AGGTCAATCTTACCGTAAATGAGGCGGAGTTTGCTCCTGTGTTTCGATCTCCTGTCCAACTTGGACAGGGGACGGCTGATTATATGTGGACATTCAAATT
TGGTGATTCGACAAATGCGCGGCGAAATCGAGTGTAAAGCACCAGGGCTAAACTTGTTGCGTGAGAGAGCGATGGAACGTCTGCGATCTTGGCCGCGCCA
CGAGTTCCTCCAAATGAAGAGAGACTGGAACCAAAGTGCCGACCGACTAGCCGGTGCGGCGCTCCAACGTGAAGGGGGTGACGTGGTTACGACTGAGATC
GAGCGCCAAGATTTGAGGACACTAAATTGAcagagcaagttgctggttCCACAAACGAGGAATTCTACCATGAAGATCTCGGCTGTAACCAGATCACGCA
AGCGACGCAGTCCCGAAGTCCTGAATGAGGAGATCGTCCAGCAGTTGAGGGCCGAACGTGTTCTTCGAGCGCACAACGAAGAAAAATGGATTGGCGATCT
CAAGAACTACCTGCGAGGGGACGTACAAGATCTCAGCTCGACAGAAGCAAAAACCTGCGTCAAGATCGCGGAAGACTATGAAATCGACGAAGATGGGTTG
CTTTTCTACTGCCCGCCATCAACGCAGTCGCGTCAAGATCGTGATCTTATCGCTCGATTGGTCGTCCCGGAGACCCTGCAGAAGGATTTCCTGCATCATT
ACCACGTCAGCTTGGAAGGAGGACATCAAGTAGTCGGACGGACTTACCAGCGACTGTGAGCACATTTTCACTGGAGAGGAATCTTTAGAGTGCAGCGATA
TGTGAGGCGATATGTGGATTGTGAGACGGGGAAGGGAAGACCTGTTATCCGAGGCGAATCACCGGGTAATTTGCAGGCGGCCTACCCGTTTCAGATCATC
GCGATGGATCACATCCCATCGTTACCTCGATCTCATAAGGGCAATACCGAGTTGCTGATCTGGGTCAACCTCTTCACCGGATTTGTAATCGCCAAAGCTA
GCGCCTCCAGGACGGCACAGACAATTGCGGAGAACTAGGAAGAGTGCGTTTTCCGACGTTTCGGCGCGAGTGAAGCAATCCGCCATGATCGAGAACCCGG
GTTTATGTCGAACTTCTTTAGATCGTTCAATAAGATTGTCGGCCAAAAACAGCACGCAACGATGGCGTACCGCCCACAGGCCAACGGAACGGCTGAGCGG
ATGGTGCAGACACTAGCTCGGGCGTTAAAGATGTACGTCGCAGATGTAGACCATAAGGATTGTGAGGAGTATGCGGAATGCCTGAcgttcgccatcaaca
ccgctcaagatcgagtgCGTGGAAATACACCCTTCTATCTGGCTCATGGCTGGGACCCGCGATCTACACTGGAAGCGATGATACCACTGGGATCGACGCG
TCACCGAGATCGTGACCCGAGGAGATGGCGATACCACATCCAGAAACTCTATCAACAAGCGCGGAAGCAAGTGAACGACCAATTGAGAGAAACCATCCAG
GATCGAGCTGACCGACACAACCACGACGTACGTCCGCATGAGGTCCAAACCGGTTCTCAAGTCTGGCAATACCtcgacaaggtgaaggaagGTTACGCAC
GCAAGTTGGCGCATATGTGGCATGGGCCGTTCAgagtggtggagatggtggacGAGTACGCTGTTCGACTCGAAATAACTGGGACAGAGTACCGGTTGTT
CCCAGTGGTGCAtgtgtcgaagctgaagttgctcCGACGGTTCCCCGACCGCCCACGAATGGATCTAGTCGTCCGAGATCAAGATCGATTCGACTTTgac
gaagcgctgctgtctgAGGACAGTTGGGAGAACGAGCTAGAGGATGGTGAATTCGAGGTGGACAAGATTGTGGATATGCGATCTGGTCGTCGCACGCGGT
ATGGGCGACTGTTGCGAGAATTCTTGGTGCACTGGAAAGGCTATGAGGAGCTCACGTGGGTTGATGAAGCTGATCTCAATTGTGGAGCACAGATGTGTGA
TTATCTGCGCGAGCAGTCCAACTGCAACCGGTTCAGCGTCATGCAGTCTCATGAGCAGCAGTAA