Transcript Name :
Phyta_totarag12284
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_262200
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Integrase, catalytic core18.389PS50994
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-335
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        1008 bases(100 bases per row)
ATGTACGAATACCACGATGTCCCTACAGCAGGGCATCTGGGTCGTGAGAAGACGTACGTTCTTCTCACGCGAGATATCTACTGGATGCACCAGTACGAAT
GGGTGCGCAAGTACATTCGTGCTTGCGAAGAATACCAACGCGTGAAGCCTGCTCCATTCTCGCAGGCTCCACTGCAGTCACTCCCGACTCCGTCGGAGTG
CTGGCAGTCCATCTCGATGGATTTCGTCTTCGGTCTTCCGCCTGATGCCAAGCGGAGGACTGGCGCAGCGGTCTTTGTAGACCGTTTCAGTAAGATGGTC
CATCTTGCTGCGGTGCTGGCTGAGGTAACAGCCGTGCAGACAACGCACCTATTCGTGGACATGATGTTCAAACACCACGGCATTCCGCACGACATCGTGT
CGGACCGTGACCCGCGCTTTACAGCACGGTTCTGGCAAGAAGTGTTCTCACTTCTTGGAACAcagctgtcgatgtcgactGTGGATCATCCGCAGACGGA
CGTACAGACTGAACACGTGAATCGCGTGCTCAGCGACATGCTCAAGAGCCACGCGCACTCGTTCCATCactggagcgactgcttgCCGATGGCGgagttc
gccatcaacaactcgGTACATGCCTCGACTGGGCATACACCGTTCGACGTGAACGCCATGCGGCATCCACGCCTACCGAGCATGCTCGGGGCGGTGGCTT
CGTCTTTAAGTGGGGGAGGATCTACGGCTGCGAACAAGCAACCACAGAAGACAACTGATACGACCACAGTATCAGTTGCGACAACGGACAAGAACTCTGT
GTCCGTGCCGGGCACAAACACCGCGAAGGATCACGCACAAGCAGGGCCTGTAACCAAGAACAACAACTATGTGCTGGTGACTCGCCGAAgtcgaggagga
agcaggGGCGCCCtgcttcgtcaacttcacGACCTTCGTCCCAAGCTCGCcgctcaagttcgaggcgGTCTGCGataccagcacgagctgaGCCTTCACG
ACGCTTAG