Transcript Name :
Phyta_totarag11373
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein PHYSODRAFT_330016
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Chloroperoxidase21.923PS51405
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.6590.7624
InsideOutsideTMhelix
272-299
350-353
409-427
488-558
1-248
323-326
377-385
451-464
249-271
300-322
327-349
354-376
386-408
428-450
465-487
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
peroxidase activityGO:0004601IEA
*** None ***
*** None ***
Sequence
        2299 bases(100 bases per row)
ATGGTTTCTATCACGACGTCGTTTGctttcgttgctgctgcctttggCGTGGTGCACGGCTACACTGAAGCTGAGGCCGAGGCTGCTCTCGCGGAGGCTG
CCGCCGTGCCCGAGGGCGAGTACTACCGCCCGCCAACGCACCTGACCTTGGGCGCCGTCAACGCCACCACCCCGTTCCGTCGGTGCCCGTGCCCCGCCAT
GAACACACTGGTCAACCACGAATACCTTCCGCGTGATGGCAAGAACGTCACGGTGGACCAGGCTCTGACCGTTGTCATGGACAAGTTTAACATCGCTGAA
GACTTGGCGGCCGTCATGGGCAGCTTGTCGCCGGACTTGTTCGATCTGAACGATCTGTCCAAGCACAACGACCGGGTGGAGCACGATGCCTCGCTGGCTC
GCATCGACTCGTACTTCGGCGAGGACCCCGACCTCATCACTCCCGGTCTCATCAACGACGTGCTGAACTACGGACTCGACGGTTCGGTAGATGCCACGGA
CGTTGCGACGATCCGTGCCGCTCGTGTGGCATGGGGCGAGGAGCACAACCCAGAATTCGACTTCGGTTTCGACGCCTGCTTTCATCGCCGGTGCCGAGTC
GGCGCTGTTCCTTCGTGGATTTGGCGGCGACAATGGCAAATCGACAGCCACGACTTTTGTTGCTACCTTCTTCCTGCAGGAAATGTTCCCGGAGGGCTGG
ACCAAACCGGACACGTCCATCACGTACGACGACACCCTCGCTACGATCTCGTACCTGAACGCGGTTGACGTGTAAACTAGTTAAGTCTACCATAGTATTT
TGGTAAGCTTAGGTTGCATTTGACCAGCCCCTGCAGCTTGATCAACACATCGTCTTCAAGCCCTCCCAATAAATCTTCACCAGTGGTGTACATACTTTTG
TGTTTTGCAGTCCTCTCTTCttactgaaaccaagtcaagtAGCCCATCATCCTCGACGTCGATGATGAGGACGTACCGCGCCTGCAATTGGCCTCGTTGG
CCCCACTTCGCCTTCCGCCCTCTTGGTCTCCGTTGCTAAGTCACCCATGGCGCACACCCCTGGACCCCATCCAGTCGCCTTCTCAACCTCAAAATCTTCT
TCGGATGAACGCACCAAACTCCTGCAATCGAGTCAAGAACCTCGACATGGAGACGTGGAGACCAAGCCGTCCAAGCACGTGGGGCTCATAGCGCTCTTCG
GTACGTCAGTAAAAAATAAAAGTGAATCTGTGCACAGGTTGGTTGACGCAATCCTCATTTTATAATAATAATTGTATTACGTACCATTGCAGCGTTGGTG
TGGTCGTGGGTGTTGCAGTCCGAGGCGTCTCAAGCTCTTCAGGAGGTCGTGCAGTTCGATAAGCCCTTCTTCATTGTGTGCTTCAACCACACAATCACGG
CAGTTGTGCTGCCTTTGGTGGTCGGCTATCACTGGGTTGCTGGGTGTGTGGAGGATCGCCACTCGGGGTTGGACGTTGTCGGGGTGCTACGGCGTCACTC
CGTGATTCCGTTCGACAAACTGTGCCGCATTTCGGCCTGTCTGAGTGTTTTCTACTTGTTGGCAGATTACTTCTGGTACGCGGCATTGATCAATGTCAGT
GTGGCGGCCGGTACTGCTATCTTCAACTGCTCGCCATTGTTCGTCTACTGCTTTTCCATTTGCTTTCTGCATGAACGACCGTCGTTTGGGAAGATTTGTG
GTGTCCTGACGTCGTTCGTGGGGGTTACGATGGTCGTCATGTTTCAAGATGGGAGCGACGCTGATATGATTGCGAGTACGAGTCTGGTGGCGGGTTTGTT
GGTCGTGATATCGGCAGCGTTGTATGGAGGCTACGAGGTGGCATTGCGACTTGCTGTTGGGGAAGATATTACTGACACGTCAACGCTGATGACGATGACT
GGGCTGTGTGGATTGTTTACTGTCCCGCTATGGATCGTCGGGAGTTTGGCGTTGGCTTACAGTCCTTTTGCGTCTCTTGCAGAACCTCTGGGATTCCCGG
TTACAGGAGATGGcgtgttcttgctgctactCAGCGGCATGATGGCGGTCGTGTTCAATGTGTTCTTGCCGTTGTCGCTGTGCTGGACGTCGCCATTGGA
AACGAGTGTAGGTGTGATGCTGACAATCCCCCTCTCGGGTGTTATTGACACATTGCTTCATCACACGTCATTCTCGTGGGAGTGCATTGTCGGATCTGCT
TTGGTGATGGGAGGTTTTGGAGTTTTGGAATACTGCAATGGTCCACCGGAGGTGCCGCGCCACCGTGAGCAGTCTGAGAGTTCGGTAATGCTGGTGTAA