Transcript Name :
Phyta_totarag11174
Orientation:
(-)
Number of Exons:
2
Description :
phosphatidyl inositol kinase (PIK-A)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Phosphatidylinositol 3-kinase, C2 domain37.344PS51547
Phosphoinositide 3-kinase, accessory (PIK) domain23.812PS51545
Phosphatidylinositol 3-/4-kinase, catalytic domain77.753PS50290
HmmSmart predictionP-Valprediction_id
Phosphatidylinositol 3-kinase, C2 domain1.8SM00142
Phosphoinositide 3-kinase, accessory (PIK) domain1.5SM00145
Phosphatidylinositol 3-/4-kinase, catalytic domain1.6SM00146
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Phosphatidylinositol 3-kinase, C2 domainIPR002420
Phosphoinositide 3-kinase, accessory (PIK) domainIPR001263
*** None ***
InsideOutsideTMhelix
1-121
145-965
122-144
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
phosphotransferase activity, alcohol group as acceptorGO:0016773IEA
KO ID
K00914
K00914
K00914
K00914
K00914
*** None ***
Sequence
        2996 bases(100 bases per row)
atgGCGAGTCGCCTCAAGGAGTACCGCTACTAcctcagcagcggcgtgagCACGGGCATCTCCGTCAAGATctcgctggtggagctggcgccCGCGCTGG
GATGCTCTGTCAGCGGTGACGCGCCCAAACGCGCCGTGTCCGAGGCGCCGCTCGCCGgcctggagcagctcgcagGCACGTCGTCCGAGGTGCGCAACTC
GCCTGTGAGCGAGATCTTTCTGACCGCGCAGGTGTTCTCCGACGGCCTCCCACTGCACCCCATGGTCATCAGGTACGCACTCGCCTCTCTACTCTCTACT
CTCTGCTCCTGCTTTCTGCTGTGTCCGGAGCGCTATAGAAGCTGATAAACTTGCCCATACGTCTCCTCAGCTCCAAGAGCCCCACcaagtgcagcaactc
caccatCTACTGGAACGAATGGATCTCCTTCCCCGTGCGCTACCGTGACCTGTCGcgcaactcgctgctggccatcACCATCTGGGGCGTGGGCTGGGTC
CCCATCGGCGGCTCCAccatctcgttcttctccaagcaGGGCGTGCTGCGCGATGGTGTGCAGTGTCTCCGCATCTGGGGAGGCCGCGAGGCGGACTCGT
CCCCGAACACCACAACTCCGtccgagatcgacgaggagtGGGTGAGGCAGGAATGTTTCCGACTGGACAAGCTCCGCGAGAAGTACGAGCGCAAGGAGAT
CGCGCGCAACGAGTGGATGGACAGCGTCACGGATCGACGCATCGCTCGCATCCGACGGGGCAGCGAACCACCGACGAGGAAGGACGCTCTCGGACCCTTC
TGCTCGTACCGGGAAGAcgcgctgctgtggctcgaGATGCCGTACTTCGGAGATGTCGTCGTGTACGAGGAGGAGCCCTACTCGCAGCGCAACCTGACGT
CGTCGTACACTGCAGACATGGGCCCTAGACGGATGAACTATGACAACGGAAGCACATCGTCATCGGCGGCTCCGTCCTACGACTCGCACACGCTGAGTGG
GTCGTACGACTTGGCCACGaccgcagcatcttctggaTCCAGAGAGCTGCCGAGCCTGGTGACCGTGTGGGACCCCGACCTCAACGAAGACAACCCAGCC
GAACGCAAGTACCGTCGGCTAGCACGCGACATCCTGCGCGGTTCGATCGATCCCAATCTCAAGCCCAGTCGTGACGAAAAGGCACGCATCGAGCTCTTGC
TGGCAACGCCGATGGACAACTTGAAGAATGAAGACAAGGATTTGCTCTGGAAATTCCGCTACACTCTGACAGACAACAAAAAGGCGGTGGTAAAATTTCT
CTTATCTGTTGATTGGAAAGACGAACTGGAGGTGAAGCAAGCGACGGATCTGCTTTCTCAATGGTGTGAAATTGATATCGCCGACGccctgaagctgctg
ggccgTGAAAAAGAGTTCAAGCACGAGATCGTGCGCCATTTTGCCGTGTCTACTCTGGCGACGGCCAAGAACGAAGATCTGCTTgacttcctgctgcagc
tggtccaAGCATTGCGGTATGAGAAACCTGGGGCTCCCATCATATCTTCTCGCGGAGCAATGAGCGTGGATGAAACCGGCAGCACGGACGGATCGATGCC
TAGTGAAAGCCTTGGCCCCTTGGCTCGATTCCTTATTGCCCGCTCGAGCACAAATTTCCAGATGGCCAACTACTTCTACTGGTACCTAAAAGTGGAGGCC
GGCGAGCAAACAAACGATTCGGAGATCTTCCACACTGTGTTAAACCAGATGCTAACGGAAATGAAGCgggacgaggagaagaaacCGATCTACGACATGC
TAATGGCTCAGCGCGATTTCATGAGTCATATATTGACAATCCACAACAAGGCTCGCGAAGAAAAGGGCAGAAAGGACCAAAAGGAAGAGAAGCTGCGGCA
CTATCTGAAACAGATGCCGTGGTCTAAGGGGACAGTGATCTCTCTTCCGCTGGATCCGATAGTTCATTTGAGTGGAGTTGTTGCCTCCTCAGCGAAGATG
TTCAAGAGTGCAATGTACCCGGCCGTGATTCAATTCCAGACAGTGATTCCTCCGATTGATCAACAGCACCACACGATCactgaaggtgaaggtcaTCATC
CGCCAAACCTGAGTCAGTCGATGTTTGGCGGAAGCGATGCCAGCATTATGCGTGAATCGTTGCCGACCCGTATAATGGGTGGTGGCCGCTCGCACCGCTT
AAAAGAAGGGCCGATGTACAAGTTCATGGTGAAGAACGGAGACGATCTTCGCCAAGATCAACTGATCATGCAAATGTTCATTCTGATGGACCGGCTGCTG
AAAAAGGTGAACTTGGATTTGAAGCTGACTCCGTATCGCATTTTGGCCACGGGCGCCAACGATGGTTTGATGGAATTTGTTCAAGATTCGTACCCGGTAT
CGTATGTGGTCTCCCACTTCGAGTCGCCGCAGATCGTGGGCTTCTTGCGGAAGCATAACCCGCAGGATGGTGCGGAGTATGGAATCGCTCCTGAGGCTCT
AAGCACATACGTGAAATCAGTGGCCGGGTATTGTGTACTGACGTATCTGCTCGGAATCGGTGACCGTCACTTGGACAACTTGATGATGAAGGCAGAAGGT
CATTTGTTCCACATTGATTTCGGCTTTGTCTTCGGAGCTGATCCCAAGCCGTACCCACCTCCGTTCAAGCTGACAAAGGAAATGGTGGAAGGCATGGGTG
GCCCCACTAGCGAGCACTACCAAAAGTTTACGACCTACTGCTGCCAAGCGTACAATTGGCTGCGTAAGAGTGCTGATCTGATTCTGAACTTGCTCAGCCT
GATGGCCGACTCTGGGATTGAAGAGTTGTCGGCAAATCCTGCTACAACTctgctgaaggtggaggagaagtTCCGTTTAGATTTGACCGACGAGCAAGCA
GAACAGTTTTTCCTGGGGCTCATCAATGACAGTGTATCCGCTCTCTTCCCGCTGCTTGTGGACTGGATCCACAAGGTTGCAACGAAGCTTAAGTAG