Transcript Name :
Phyta_totarag11173
Orientation:
(+)
Number of Exons:
5
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Tetratricopeptide repeat240SM00028
Tetratricopeptide repeat4.6SM00028
Tetratricopeptide repeat0.91SM00028
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1517
NN-scoreoddsWeighted Score
0.5151.2380.002
*** None ***
TypeScore
nuclear826
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        6156 bases(100 bases per row)
ATGAGTGCGgcaagctccagcacgatgcGGCCTCCTTCGCAACCACGAGATCAGCTCGTGCTTCAAGTTGAGAATGTTGCGCTCGCTGGGAGACTGCTCA
CGATTGCGATTTTCGAGGTGCAGAATGTAGCACTGACCAAAGGAACAGGGACACCGTCATCACCTCTTCGTTCTACACCGTCTACACCGTCAACGCCATC
AAGCTCTGCAAGGACCACCGGGTTCCGAGTAGCAGCTCGAGATGATGTGGAAAATGAATATTCACTATTCGTGACACGGCAAAAGGCTGAATACTTGTAC
GGGGCAGCATACCCAGTCGAGGCCGCTGCTAGTGCCTTGATCACTCCTGAGGCTATGGCGAACGGAATTCTCGCACACCTCAACATCATTGGCAATCGAC
AGAGAGATGTAGGTAAACTCATATGTCGCGAGCCTGAGCCACACGTCGAGAAGAAAACTCGTGTTTTACCCGTCAGCACTCCGCCACATAAGCAAAAGAA
TCCACATCTACCTTCCAAGCGTCAGGATCAACGCGCTGTTCGAGTGCAGAAAACGTCAAAGAGAACGATGGAAGCAGTCGCACAAGCAATGCGGCGTCCA
GACCCTGACTGGAGCGGAGACAACgaaagtgctggaagtgaGGTGGAGGCAGGAACAAAGATTGATCGGAAAGGTAGCGAAGCAAGTCTCTTGCATCGCA
TGGCAGTTGCCGACTCCAAGACAATGTGGAAAGCGGAGCTGGAAACGAACTACGAGGAGTCCGAACATCCGTCTCTCTTCGAGAGTGACACATCAACAGC
AACTCAAGAATACGCTTTAGCACCAGGGTTGTCACCGGTGAAAAGAGCCCTTCCGGaacgcaaaacaaaacacaagGATCTAGAAGAGCGCCGGCAAAAG
GGGCGTCATCAACGCATTTTGATCGCCCAGGCTGCACAAGAGTCCCCTTCCTCGACACAACTCGGCTCTATTCAAGCTCAAGCCTCCTATTCTGTTATGA
TCGAGGAAACAGAACAAGACGTAGATTTATTGTCACCAGGTGCTTCAAGGCGAACCTCATTGATCAGCGTGAGTAGTACGGAGAAGGCCATTTCCCAGCC
CAGACCTTCGTCTGCCCCTCGGTCGAGTGTCATTGTTGGCAATGCGTATGGCCTGAAGAATTTGCCTAACTCTGACGCACCTGAACCGGAGCAATTTCTA
CGCCGGCGAACATTGGACGCGCACAGAAGCGTGTTGAAAAACGATCACTGGCCGGACGACATTCCTGGAATGGGAATTGAGATCACCGATGAACGGCCAA
CCCTTCAAACGCCGCCAAACCAGCTTGACGCCCTGTTGAATACTGCGCGTCGTGTGATGCTGATGAATTCACTGGGCTCGACGTTAGAAAGGAAGCCAag
caacgtgaagctgagAAAATCAAACAGGACAACGACTTCGCCTACGCTAAGCCTCTACTCGACTGCTTTAAATTCATCGAACTCGGCACCAATTCTTCAA
AGTCCGAAAGTCgaaaaggtgaatgttgctcCAACGCTGGCCTCAGATGAGAATTCTACTGGGCCCCAATTGAAAGCTGAAATTGAGTCAAACATTGAAA
ATAAGCCTCAACTTCGATCAAAGTCGACGAGTGCTGAAGCAAGTAATCAGCCAAGATTGACGTCAATCAGTCCCATTCCCCCCATGATGAATCCTGAACC
TTTTCAAAACCAAGTTGATGATAAATCGCCTCGACCAGAGGATATTTTAACGCCTAAACCTTCAGCAAGCTCAATATCCGACTGCGAAGAAATGCCGAGC
AAATCGAGACCCCGGTCCAATTCCGTGGGCTCTGAGGGAGTTGTACGCTTAGCACCTTTGCCAAGAGCAATTAAGCCATCCGTCCAGGAATTTCTGACCT
CGCCAGAGGCAAAAACTACTGATTCTACGAATGCTGCTCCCCAATGCGAAGTCGTTTTGGAACAAGAAGCCCCAGCGCTTCCTTTAGACCCTGATGTCGT
GCTTTATCCTCCGAAGGATTTTACAAGTGATACTCCAATAGATAAAAGCGAGGGGAGTGTGGACGGAGTATCAACGGCCAGCAAACTGAGCTTTGAGGAA
GTTAAGGAAGAAATGCGGGAAAGCGAGAACTCTAGCTTGCCTAACCTCGACGCTGTAACGATGGTGGATGTAGCAGTGCAAGGAGACCAGACAAATGCTT
CCCAGCAGGTTTTGCTTCCAACCTCTGCGCAAGATGTGGTCTCCCCACCAACAACTCGAAAAGGATGTTGGGAAGACCCCGTCCTTGCTGTGACGTCGTC
CGAGACACCCGAGGAAACGATTGAAGAGAATCCAAGCACTatagcagcaacagtagtGGCGAGCCCACCGGAGACTGAGATCGAGGTGCAGCAAAATTCG
GTAAAGGAAGATGGCCTTGAGATCCAACCTGAGAGCGCAATGGCGATGCCGAGCCAGCTGCAAGGGGCAACCTTAGAAGAACAAACGAGCGAAATACAGC
AGAAGGAATTGACCAAGCTGCAAGAAATGCTTAAGAATGTCATACCCGACAGCCAGATTCAACGATCTAAAGAACTACCTGCGGACAGCGAAGATCACAG
TGATCAGTACGAGTCTGGAAGCAACGATACTCCTATAGGCTCCGGTGAAATACTTGTTTGCCCCGCTTCTGATATTATCAACGACGCAGAGCGTATTGCC
GATAAAACCAAGGGTGTTGTGGATATTATTGACGATATCACTAGTGGAACAAAGGAGAGTGAAGGTAGTAGTTCTTCTGTAGAGTATCACGCAGATCCAC
TGCAGTCAAAGGAGGGAACTGGAAGTCACGAAGTCTCCACTGATCGTAGTgtagacgacgatggagaccATGGCACGAAAGTGTTAGAATCCCCAGTAGT
CTGTAAAGACCTAGGCGGTGAAAGTACGAAGAGTCCTCTTCATCCAATTGCAGATAGCCCCGACGAGACCATTTTCCCTCCACTTGGCGGCGATGAAAAG
ACTGGCGCAAGAAAGCTAAACGCAATAGCTCGTGATGATGACCCATCACCAACGGCTGATTCAAGAGAAAACTTTATCCAACTTGCCAAGCTGGTTTTGC
CGTATGAAGAGCCCGGGAGTGAAATGCTTAGCtctcaagacgaagacagcaATCAAGAACGCGAGAAAGACATCGAAGTAGGCACCAGCAGTTCCCAACA
AATAACCCCGGAACGGCTGCAGAAGACAGGAACTGATGATGAGATGAAGGCCATGGACCAATCGGCTATACCAGAATTTATTGCTATCAACAGCAAAGTT
agagccacagcagcacttcctgtTCAACAAAAACAACTCCCAATAGAATCATTTCCAGAACGCGAAAAACCGAGCGGCATTTTACGCAAAAAGTCGATGA
GTCCCAGCAAAAAGTCTGGACCAACAGGACAAGTTAAGACGACTTCGAAAGTATTGGgctcaagacgaagaagtacCGTTGCACAAAAAGAAGATACTCA
GGTGGTGACTCAACCAACGCCCAAATTCGGGCGACGACATACAACAGAAGATGTACAGACGGATGATCTTCAACGTGGTATGCGACGTACGAGTACGATC
GACCCAAGTGGCCTACTACCAGGTTTACCGTCTGCAACTGCTGTGAAGACTGCGGTCAAAGTGCCCACTGAAAACAATTCCGGTCCGGGGCTCCGTTCCA
ACAACACACGCCAAGTCCCGTCGAATCGGCATTCATCTCAATACTCTGGAGTAGCTCAGAGCGTGACAAACTACCACAAGAAATGGGGTAAGTGGATTAC
TGGTAAAAACATAATCGAGAAGGTTGGCTGtttgcagctggaagagcttgTCATGGCGGATCCACGAAACGAGGACGATTTACTCCGGCTTGGTCTTCGT
TACGCTCGGTGGCCAGGAACAAGCATGGCGGCGATTTTACTCCTGGAACATGCAGCGCTATTGCATAAGAACGCAGCAGGGTCGCGAGATTACTGGTTTT
GGCTTGGGTCAGCACACTTGGATATCTTCATGCGTCACCGTAAGTATCTACCCATTGCGCGATTTCATCTGAGCAAGAGTCTTCGAGCATTTACGAGTGC
TTTCGCGTACTTGGAGAGCTTAGTGGACCCGATGCTGCTTCTCCGTTATGCAATTGGCCTTTTCTGGCACAAAGGCGACGGGAACTTGGAGAAGACACGT
GATATTTTCCAAGAGTTGTTCTCGCAGTTTGTGAGCTTCTGCGATAAGGACCGACCGAACTTGTTGTTTCTCCAGTTTCAAGTACTTCATCGCCTGAAGC
TCTACGTGGACGCGATCGACTGTATGAACAAGATCATCACTCTCCATGACAGTCTTCCGCATCAGGCAACACCGACGGGTGTTCCAATTCTGTCTTCAGC
AAGCACAATGCCACACTTTGCAGTCTACGATGCTGCAGATTATCGGCTTATGTTGATGCAGTGTCAACAGACCAGCGGAAATTATGTGTCTGCAGCTCAA
AGCCTTGCTTGGGTTTTGAAGCTCAAGGGTGTGCAGCAAGATGCCGCGCTCAAGGATGAAGAGTACTTCGATCTGTGGTTCTCTCTGGCCGAGAAATGTT
TTCATCACGAAGACTATGTGCTCGCGTTGGAGTATTATGCGATTGCGCTGAATTTCGCAAAACAATCTCAAGTGCTCGCCGCCATCCACAACAACCTCGG
GCTTTGCTTCCACTCTTTGGGTGAAGACAACAAATGCGTAACGGAGTACAAACGCGCACGCACCGCGAATCGCCACGTGCCTCCCTTGGCTTCACTCACT
GAGATCAGTACCCCTTATGACGAGCGCTTTGCACAGCTCCTTCAGAAGTCTGTTGTCCAGACGATCGAAGAAGTGCGTGTGGAGTTGTATGGCAGAGCCG
TCCGACGTCTACAGCGTGTTTTCCGGAAGAGCCGAAAAAACCTGAATATCAACCTCGATAGCAACAGCTCGGACAGTCCACTAACGAAGATGCCCAGTTT
GTCCAAGCGGAGGTTAAgcatcgcagcagctcgaaacCCCCCTGCTCTTGTTAAAATTGAAGCCAGCACCGAAGTAGCAAAGGccaatgaagaagaaagc
ctGCCGCAAAAAATTGTGGCCGTTGATGATAACCAAGCCAGCAGGTATGAAGATAGCACccttgaagtcgtcgagcgCCGTCACGAGTCTTTTCTTGCGA
GGAAGCAGGCGGCAATGGACGAGATAGCTGAGCTGCTCACGAACCCACAGTATCGAGGCCGAGAATCATCGCCGTTATCTCGTTCAAATGCACGGCCCAA
GGCTGCTACACAACTGCGCAGTGGACTTCTGTCACCCGAGAAAGATCGCCTGGACGCACGTCGGACGCAGTCCATGGAGACATTTCATCAGGTATGCCAC
TCTGTTATTGTCTGGTGGTTAGTTCCTGTAAGTTTTGAGCTTTACTCACGCTTTATCAACTGTATCTGTTTGTTGTTCGCACAGCTTGGCTACATCTCCT
CAACGATGCCATGGATTGAGTTTTGGGAGAAGCTGCTAGTTCTTGCACCAGACCTTTTCGAGTCACGGCAGGCTTTGTACGGAAGCATTGCACGAATTCG
AGGCCGACTACCATTAGTGACTGATGAAGTCGCCTTCTGTGCCCTGGCTGAAAGCATCGGAAATGTCTACGAAGCAGCCGAAAAACTGCATGATACGTCC
CACGAGCGAGAGCTCACTTACGTGTGCGCCGTCATCGAGGTGTCGAAGCAACTCGAACGAGATTTTCCACTGGGGCCCGCGCAACTGTCCATCAAACCTC
CTCACGTCTCCCTCCCTACCATTTCGTCGCCCAGGGCTACTCATGGATCGCATAGTCCTGTTGGGGCACTGACATCACGCCACGTTGTGTTGCCTCCGTA
TTCCCCGACCCATGCGACGATTGCGTCTATCTCCAAGCCGAAAAAGCACCTTCGGATGAACCAAATGCTCAACTTGCACTTCCAGGAGCACGTCCAAAAG
CAGGAAGCAGCAATCGCAATAGCCGAGGCAACGGGAGGCTTTGTGCAGCCCCAGCTACGAACGGAGAAACTGATGGTACTTCAAAATTTCCGGCAGGCCA
ACGCTGTTCTCCTGAGTTCGCAACTGGCATTCGGTAGCGAGAAAGCGGCCACATAA