Transcript Name :
Phyta_totarag10676
Orientation:
(+)
Number of Exons:
4
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5650.65431
InsideOutsideTMhelix
1-434
NN-scoreoddsWeighted Score
0.7382.8220.006
*** None ***
TypeScore
cytoplasmic435
GO
*** None ***
*** None ***
*** None ***
Sequence
        1937 bases(100 bases per row)
ATGTCAGAGTTGCTGAACCTCGAAGAGATGTCGATGGAACACTTCTTGGCCGAGTTGAAGGCCGAGGAGACCGCGAAGATGGTGCTTCTGCAGCCGGAAC
CATCTCCTGAGGGATTCAATTCCTCCTCTGGCATGGACGAGGATGTCCTGGACGTAttccggcagcagcgcgcgtCGCACTTTGGTTATGCGGTTCTCTA
GAACCCGAAGGATCCGACGTATCCTTTATGAAGGCGGTTGCGGACGTGGTGTCGAAGAATCCATCGTCCCAACTCCCGCCGGATCGGGGCATCAGACACG
ATATTGATCTCATGCCGGGCACAACGTACTGTGTCACCAGACCATGGCCCTGCCTCGCGAACAGTGCGAGGTCATAGATGCCTTTTTGTcacgaagtcga
agccaGGCATGGTGCGGGAGTCGAAGTCCCGCACTGGACGCAAAAAAATGCTGCGTTCGGAAGCCGAACGGGAAGTGGGGTCTGGTTCACGCTCCCAACA
AGCTGAACAACGCGATGGTGCCGGCCCACTCACAAATTCTTCGCAAGGATGTGTTGTTGAACAACATGGCCAGCTGCACACTATATAGCACATTGGATCT
GGTGGATGGATACTACCAGATCGTAATGCGTGAGAGCGACATCCCTCTCACGGCAGAGAGCACGCCGAGCGGTGTGCTCTGGGAGTGACTGGTAATGGTA
CATGGGCTCTCGAACGCCCCAGCGACTTTCAATCGCTTGGTCGCGCAATTGTTTAGACCGTTGGGTGCGTTCTCACAGATGTGCTTTGACGATATTTTCG
TCCACAGCCGTGCCGACGAAAGCAAAACGGATATGGAGGTGCAAATGGAGCACCTTCGGCGAGGTTTTGAGGTCATGAGAGCCAACAAGCTCGATGTCAA
CATCGACAAGTGCGTCTTTGCGGCGGAGGAGATTAAGGTCCTCGGTGGCTTGGTCAGCAGCGTTGGGGTCCGTGCAGACCCGGAGAAGGTCAAAGCCATC
GCGGCTTGGTCTACGCCCAGATCCCAAAAGGATCTTAGGAAGTGGCTGGACCAACTACCTGCACAAGTACAGTGCAGGGTTCGCCGGCCTTTCGCGGCCT
TTGTCGGGTCTCTTGAAAAGGATGCCGACTGGCGCTGAGAGGGCCAGTACCAAGCAGCGTTTGATCGCATCAAGGCGAGCTTATAGCGTGCGCCTGTCCT
GGTATTGCTGGATTAAACGAAGTCATTCCGCGTCGTTTGTGACGCTTCGGACTATGTAATAGGCTGCGCAATGTTGcaggacgatgaggatggaCGAGCG
TGTCATCTCGTTTCAGTCCAGGCAGGTGAAGTCTGTCGAACGGAATTACCCCGTTCATAACAATAAGCTGCTTGCAATGAAGTATGCCCTTGTCAAGTTC
CGGTTACATCTCCTGGACTCGAGGCCCATTGTGGTCTGCACGAACCACGCGTCCTTGCGGACAGCCACCAACTCGCCGCATTTGTCGCAGAGGATGGCAC
GTCGGCTGTCATTCTTCGCGGAGTACAACTTCCGCGGCGAATACAAGCCGGGCAAGCTCAATGTGCCCGTCGATGCGTTGTCACGCAGACCCGACTATGA
GTTGGCACACATAAGTCGGGTCACGACAGATCTATATCATCGGATACGCATGGCGTATCGGGACGACGAGAGTCTTGCGCCCCTCATGCGGTTTCTAGCC
GCTGACACGGATGCCAAGGTCGAATGGATGTCGCCTCGACAGTGGGCACGTCGCCACCGATATGGATGGACTGGCGGCCAGTTCCACTATCGCGTGGAGC
CCGGTGATCCTCCTCGAGTTGTCGTTCCGAACGACGAGGATCGGAAGTATGGTATACTTCTAGAAGCGCATGGTGCGCCTTCTAGCGGCCATTTGGGTCG
CGAGAAGACCTTCCTGTCGGTCTCTCAGACGTTTTAG