Transcript Name :
Phyta_totarag10138
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_525100
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Pyruvate kinase1.1PR01050
Pyruvate kinase1.1PR01050
Pyruvate kinase1.1PR01050
Pyruvate kinase1.1PR01050
Pyruvate kinase1.1PR01050
Pyruvate kinase1.1PR01050
Pyruvate kinase1.1PR01050
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-492
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
pyruvate kinase activityGO:0004743IEA
magnesium ion bindingGO:0000287IEA
glycolytic processGO:0006096IEA
KO ID
K00873
K00873
K00873
K00873
K00873
K00873
K00873
K00873
K00873
*** None ***
Sequence
        1481 bases(100 bases per row)
ACGCCGACTGCATCAAGGCCAACGTCGAGGGTGTGCAGCGCAAGACCAAGATCTTCTGTACGCTTGGCCCCGCTTGCTGGTCCGAGGAGGGCCTGCTGAC
CCTGATCGACGCGGGCATGAACGTGGcccgcttcaacttctcgcACGGCGACCACGCGAGCCACCTGGCTTGCTTGAACCGCCTGCGTGCCGCGCTGGCC
AAGCGCCCCAACAAGAACGTGGCCATCATGCTGGACACGAAGGGCCCCGAGATCCGCACGGGTTTCCTCAAGAACCACGACAAGGTGACGATCCAGAAGG
ACTCGCTCATTGAGCTGACGACGGACTACGAGTTCCTCGGTGACGAGACCAAGATTGCGTGCTCGTACCCGCAGCTGCCCGAGTCCGTGAAGGTTGGTGg
ctcggtgctggtggccgaTGgctcgctggtgctgacggtCACGGAGATCAAGGACAACGGTATTGTCGCCCGTGCCAACAACACGGCGACTCTGGGCGAG
CGCAAGAACATGAACCTGCCCGGGTGCAAGGTGCTACTGCCGACgctgacggagaaggacgaggacgacctggTGAACTTCGGTCTGGTGCACGGCATCG
ACTACATCGCCGCTTCGTTCGTGCGCACGGGCCACGACCTTGTCAACATCCGCAAGGTGCTTGGCCCCCGTGGCCGCGGCATCAAGATCATCTCAAAGAT
CGAGTCGCACGAGGGCTTGGAGAACTTCGACGAGATCCTGGCCAAGACGGACGGCATCATGGTGGCCCGTGGTGACCTGGGCATGGAGATCCCGCCTGAG
ACGGTGTTCCTTGcgcagaagatgatgatcCGCAAGGCCAACCTGGCCGGCAAGCCCGTGGTGACGGCCACGCAGATGCTGGAGTCGATGATCCATGCAC
CGCGCCCGACCCGTGCCGAGTGCACGGATGTGGCCAACGCTGTGCTCGACGGCACGGACGCCGTGATGCTTTCGGGTGAGACTGCCAACGGTGACTACCC
GGTGCAGGCTGTGGAGGTGATGGCTGCGACGTGCCTGCAGGCCGAGACTGCCATCCACTACAACGACGTGTACCAGTCGCTGCGcaacgccgtgctggag
gtgaaCGGCCCGATGCAGACGGCTGAGGCCGTTGCGTCGTCGGCTGTGAAGACGGCCATCGACATCAAcgcgaagatgctggtggtgctgacggagaCGG
GCAACACGGCTCGTCTAGTGGCGAAGTACCGTCCGCAGATGcctgtgctggtgctgacggctCTGGAGCAGACTGCTCGCCAGACGGAGGGCTTCGTGAA
GGGCGTTGTATCTCGCTGCGTGGGTTCGATGATCGGCACGGACTCGATCCTGTACCGCGCCACGGAAACCGGCAAGGATCTTGGCTGGCTGAAGACGGgc
gatgctgttgttgctgtgcacGGTATCCAGGAGGCCAAGTCGGGTTCGACGAACCTGCTGAAGGTCCTGTACGTCGAGTAA