Transcript Name :
Phyta_totarag10016
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein PHYSODRAFT_350945
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
860-875
1-839
840-859
NN-scoreoddsWeighted Score
0.541.8130.004
*** None ***
TypeScore
nuclear348
GO
*** None ***
*** None ***
*** None ***
Sequence
        5373 bases(100 bases per row)
ATGGAGCCCACGtcctctccagcagcgctgttGGCTCCTCTTCCCTTCGTGACGCTCTCCGACGATGGCAGCTTCGAGATATCACCTGAAGCCGTCGCGT
AcctgcagcagatccgcGGAGAcatcgccgtcgtggccatcgCCGGTCTCTACCGCACGGGCAAGTCGTACCTTttgaacctgctgctcggaCGCGACCA
AGAGAGCGAAATGTTCGACGTCGGAGCTACAGTCAATGCCTGTACCAAGGGCATTTGGATCTGGGGCCAACCGGCAGCCAATCAGAATCTCCACCCGGCC
TTTAAACACCTTAGTAAAGACACAACGATCGTCTTCATGGACACCGAGGGGCTGGGCTCCACCCAACGTTCCCAAACCCAAGACACGCGGATATTCGCCC
TGGCTTTGCTGTTATCCTCCATGTTCATCTACAACAGTCGAGGGGTAATCGATGCCAATGCAATTGAGGACTTGTCACTTGTGGTGAACTTGACCAAGTA
CATCCAAGCCAAGGCTCATCCCGAAGAGGagaacaaggaggagggcAGTGAACTGTCCATGTTTTTTCCTGCTTTTCTGTGGGTTGTGAGGGATTTCACT
CTTCAGTTGGAAGAGGACGGGAAGAAAATGTCGTCGAGGGACTATTTTGAAAGTGcactgaagcagcagcctcctTTGACGGAGGAAGTGATGCAGAAGA
ACAGGATTCGATCGTTGCTGTCAACGTTTTTCCCATCGAGAGATTGTGTGACGATGGTGCGACCACTTAGTGATGAAGCACTACTGAGAGACTTGATCAG
ACAGCCGTATGACTCGTTGCGACCCGAGTTCCGTGAGCAGATGGACGTATTGAAGAATAAGTTGGCGACTTCGCTGAAGCCCAAGACGATGATGTCTAGA
GTACTGAATGGAGCAATGATGGTATCATTGACGCAGAATTATGTGGCAGCTTTCAACAGTGGATCTAATCCGGTTATTACGTCGGTATGGGATCGAGTCC
TGGAGTCTCAGTGCGATCAAGCCTTGGACTCAGCCAAACAGACTTTCCAAGCGACGATGGATGCTGCAATTGCGGAGAAGACCAGTACGTCATACATGTT
TCATGTGGAATGAACTTATATAATTAAGATTGAAGTCTAAACTACGATTCTCTGTGCAGACCTAGCGATGCTGAATCAAGTGATGCGTGCTCTCCCACTC
GAAGATGCTGAGTTGGTTGCTATATACGAAACAGCTAGCGACGCTGCGGAAAAAGTGCTGCTACGTGAAGACATCACGTCGTACTCGTCAATGGAGGCAT
ACTCTCTCCAACTTTCTAAGTACAGCCTTGAATTTTTGCGGAGAAAATATACCGACAACGATGCAGCGTCAAGTGCTTATAACAAGGAGGTACGCCAGCA
GCTGTGTAAACCTCGCAAGGAAACCCTCGATGATCCATCATCAGTCGCAGGAGACGGAGCCCAGCAATTGCAAGACCAACTGACAGCCTCTCGAGACCTT
CTGGACAGTATTGTGACGCAATACAAATCTCGTGCCTTGGGATCGTGCAAAAGCTTGGCATTGAATAACTTTCTCATCGAAAAGATGGTCGAGGGCATGT
TCGAGTGGGGCGCTATGGTGAAGATATTATTTCGATCGAAAGAGGCCAAGCTGGTGAGTGATGTTGCGTCCACTCAACAGACCTTGCGATCTATCGAGGC
GAAAGTTCGTGTAGCGCAAGAGATGCTGGCTCAACAGAAGGACGCTTACGAAAGAGCCGTGCAATCAATCGCCGAGCGCATAACTAGTGAACGAAGCACA
CTTCATGATGACATTCAGAGCAAACAAGTGCAGATTGATCAAGCTCATTTGCAAGTTGAGCGATTGAATGCACTCCATCAAGAGGCACTCGATCGCTCAG
ACATGCAAattcaagaagctcaggaTGAGCGGAAGCGGCTCGAGGCTGATGTCCGCGCTGCTGATGTCCGCCGAGATAATGAACGGCAAGATGCTCAGCG
CCAGTTGCTAGAGAGGGAGCACAAATTTCATACTGAAGAGAAAAATTTGCTACaaggccagcagcagtttttGCAGAAGGtcctcgagctggagcggcAG
CTGGGTGAGCTAGATACCAACCATATTGCTGAGCTCTATTACATCGAAAAAGAAAACAACGAAGAGATTTCGCAATTGtctctccagcaccaagatgagc
aggaagagctgaaggagaGCGCAATTCGGGTAAGAACTCGTATCGCTTGTACTACATGCAGGTTTTTTGAAGTGCTAATCTACTTGCATTTCTCCAGGAC
ATTCGGGCGTTGAAAAttgaacacgaagaagagacgTGTGCACTGCAAAGTGACCTGGACGAAAAGAGAACTCTTGTGGCTTCTCTTCGCGAACTACTag
acgagaaggaggctgctgcagcaaagaAAAAAGTGAAGGCCAATCAGATCTTCGGCGCAGAGGAATGTATCGTCCAGTGAAGAGATACCTGATCAGTGAA
CCGAATCCGTAATATTGTTGTTCTCTGACATTAATTTCAGGGTTACTGGTATGCGATTACAAGATCGTCTCTGAAGTAGGCGGGGAATACACGAATAAAT
AATTTTTGATTGATCGGAATTATTTAtaatatatatattttttaGTAAACTTACCTGATGCAATTCTTTATTCATTACCTGATTGCGTCTTTTCCCCCTC
ATATCTGCTGTACACTGTTGCTGAAGTGTCGAGGCAACGTGATTTCTGCATTTTACTGCTTGACAATTTTCGTTTTCTTCACTGGTGGATCGGTGGACTT
GTTTGAATTCAAGCTGTCGTTAAATTGGCAGCATTCATccgagaacgagatggtgtACAAGAACACCCAACAACCAGGCGCCTACTTCAATGCCGGCGCC
TTCCTGGGGAACAAGACGCGCATTAGCAAGTCGAACGAGCTCCTCAGCTCCTCAATGAGGTCATGTTCACAGTTAAGGCCAACCCGGACGTGTCGTACAC
ATCCTTCCAGGTCAGAGAAAATGTGTTTATCAACCGGACGAGCTATTGCTTCTCAGCCGGTTTACCGAGAAGGCAGAAGCCGGCAGGTGCTGGTCTCGGC
GGCGGCCGGGGGTTCGGAGGTGACTGTGGGCGCTATTAGACTGCTTAGCCTCTCCTGCTGGAACACTTCAAGCAAACGACTGGATCAATTGTGACACCAA
CTGCAACGCgaatgttgcagcaggttacGCTGACGCAGAACTGGTACAGCACATAAGGGCCTCTATCGAGGTATTTCCAGTATAATCCCCGGTACAATTC
GATTCTGTGGTCCAAAATTCCATTTAATGTGGTTTCAAGACAAAAGGCCACCACAGTCACCTGCACATACAGTAAAATATACAAAGCATCGTTCCCTGTA
GTGTTGGTTTTGTCCGCAGTTTAAGCTGAGTTCTATCGACAAAACTAAATTTAAACCGGATTAAACTGCGGACACTACCCACTAGGCATTGATATGAAGA
ACATACGCAAGCTGAGACCTTACATAGGATACGCTAACAAGGATAATACTGTCCACTTGTACGCAGAAGAATCATAGAGCATTCGTGCCCGATGCAAGTT
GCAAATTTATTAAGTTAAGGCTAAAATTCACGCTAAAAGTTGCGTTTCCAAGTAGTCGAGACTGTAGTGGAGAACGTAGTCAATACCGTGGCCCAAACGT
TTttcgactgcagcgacatgatcttcttcctcgccatcgtcttcagcttgctcaTCTTCACTTTCGTCTTCATTCGAAGCAAGGTCGCGCACGCAGAGTG
AAGCTGGTACTCGCAAGTGTTAGAGGCAAGCAGGCAAANCATACAATATGTAAGTTTGTTCAACATGGGACCAGTACACAACAATCCTCAACAGTCTTCG
TAGCAAACCCCGACCATCTCTCCGTCTTCGTTGCGGTTCTCGTCAACCGCACCTCGACTTAAAGTCGACTCGTCAAACACAACCTCGGGAATGGGGCCCT
TCCCTATGTGATTGCAGTAAAAAAACATGAGCTTGCTTAACGGCTCCAATCCAAGCTGACATCGTCGATCAGAGTAGATACAGCCATGTGCACCCCAGTT
CCTTTCAGTTGACGCCGATAATGTTAGCATCGTGAAAATCTTGCGCGCGATTCGGTAGAGGACTGGGTAGGTATCACGCTTCTCGCCCAACCACGCTAGA
GGTGCTGTGCGAAATTCCTTCCTTCGCTTCAAATCGAACCAATCTCGCTTGCGATTCCAAAAATTCCAGCCTGGTGAAATGCAGTTTTTACTTCGTCAGA
CTCGAAATCTAGTCTCTTCGCCACTTTGCGAATCTGCTTCTTGGATTCGTCGCATTCCTTGCCGACAAACCCTAGTGGGTCCATTGATGGGTCCAACAAG
CAGGCAATCCCCATTGCATCCGTGTGCGAGTTGTCCCACCTAGCTTGTATTGCAACACGGATGGTTTTAGCCGTTTCGACTAGAAACGTAGGTTTGCGGC
ACATTGGCTTGTTTTAGAAGGTCCTTGAAACTCCAATACACAAAGCAGATGCAAACTTTAGCCGGCTCCAGCAGTTTCATCACTTGTTCACCTTTCACCT
AGAAgtcatcgtcgctgtagGATATCCATGATGGATATCTGGGTTTCCGGACAGCAAGTCTCATAGATCGATTGCTGGACTTCGAGAAGAATCGAAGAAT
CCAGAAAGAAGGCACTCGACAGATAGGTTTAGGCTAGGTATGATAGGCTGTGCCTCTCACTTGTGAATATTCTCACTCGACTCGATAATCGTCGACTGAG
TAGGGTGTGAGGTTGTCACCAGTTCGTTGATAACAGAAGGTCAAACGAAAGCGACGGCAGGAAGCTAGAGAGGTTTCAGTTTCTCGAGACACTCGACGGA
ATTGGCAGAGTTTCAAGACGTCGTTGGTATTCATATTTTGCATAATTAGCGAGCAACGTAGGTAATGGGAGCGGTGGTTACATATCCACCTTCTACGAGC
ACGACTCCTCGCCTCACTCTCTTAGCATCGACAAAACAAGCAGAGCAACCCACTGAGCCATCGTGTTGAAGCTTTTTTCTACCCAATCCCAACTTCCTCG
ATTTACGCAAGGCAAGGAGTCCACACGACGAGAGGGAAGTCTGCTCTAGGTATAAGTGGCACCATATTGCGACAGAGGTTGGCATCTTTACGGAACGACA
GCAAGTGGGTCGTCACGGGGTCGTTCCAGAGTGAGTTCCAGAGCGCCCTGCGCTCCAAACGGGGAGGCCTCCTAATCATGTATCTCTTGGCGATCATCTT
CCTCAAGTATGGCGGCACATTCGCACAGGACAAAAAGATGGACGGTACCTCATCATACGAGCGGCGTTGGTAG