Transcript Name :
Phyta_totarag9244
Orientation:
(+)
Number of Exons:
1
Description :
DEAD/DEAH box RNA helicase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA helicase, DEAD-box type, Q motif9.873PS51195
Helicase, superfamily 1/2, ATP-binding domain29.786PS51192
Helicase, C-terminal23.764PS51194
HmmSmart predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain1.1SM00487
Helicase, C-terminal5.9SM00490
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Helicase, superfamily 1/2, ATP-binding domainIPR014001
RNA helicase, DEAD-box type, Q motifIPR014014
*** None ***
InsideOutsideTMhelix
1-617
NN-scoreoddsWeighted Score
0.6512.2260.004
*** None ***
TypeScore
nuclear652
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
nucleic acid bindingGO:0003676IEA
helicase activityGO:0004386IEA
KO ID
K11594
K11594
K11594
*** None ***
Sequence
        1854 bases(100 bases per row)
ATgcgcggcggtggcggcggtggtgaccGCGGccgtggcgacgacgaccgtCGCGGAGGCTTCGAGGATCGCCGAGGCGGCTCGCGCGAACGCGGCGGCT
ACGGCGCTCGCAGCGGCTCCCGCGAACGTGGCGACGGCCCGCCACGTGCCACCAACTCGCGCTGGTCTGGCTTCGAGTCGGACCGTCGTGACGACCGCCG
AGGAGGCTACGGCGACGACcgtcgcggcggcggcggctacggtggtggcggcggcggctacagccgcggtggtggcggccgcGTTAACGAGATGGGTTAC
CATGGCGATGTGCGCCCCAACGAGCGTCTAGAGCATGAGCTGTTCGGCGATGCCAAATCGTCCGGTATCAACTTCGACAAGTACGACGACATCCCCGTCG
AGACGAGCGGTGAGAACGTGCCGGACCCGGTCACGGAGTTCTCTGCCGAGGAGCTGGGCCCCGAGGTCATCCGCAACCTGGAACTGTGCAAGTATTCGAA
GCCCACTCCTGTGCAAAAGTACTCGATCCCGATCGGCCTGGCTGGTCGTGATATGATGGCCTGTGCCCAGACGGGTTCCGGTAAGACGGGTGGTTTCCTA
TTCCCCACGCTGGCTGCTATGCTGCGTGTGGGAGGCACTCCCCCGCCTGATGTCGGCCACGGCCGTACGCGCAAGATTTTTCCGGCGGCTCTGATCTTGT
CGCCCACACGTGAGCTGGCGTCGCAGATCCACGAagaggccaagaagttctGCTACTGCACTGGTATCGCCCCCGTGGTGATCTACGGCGGTGCCGAGGT
CGGCCGCCAGCTGCGTGAGCTGGAGCGCGGATGTGATCTGCTGGTTGCCACCCCTGGACGTCTTGTCGACCTGATGGAGCGTGGCCGcatctcgctgtcg
tgcATCCGATTCCTGattctggatgaagctgatcgCATGCTGGATATGGGTTTCGAGCCCCAGATTCGTCGCATTGTCGAGCAGGAGGACATGCCTCGTG
AGCGCCAGACGTTCATGTTCAGTGCAACGTTCCCACGTGAgatccagcgtcttgcgTCGGACTTCCTGCGCGACTACATTTTCCTCACAGTTGGCCGTGT
GGGTTCAGCCTCGAAGGATGTTAAGCAGACGGTGGAGTACATCGAACAGTACGATAAGGAGGACTACCTTGTGCGTTTCCTGAACCAGGTGCAGGACGGT
CTGATTCTGGTGTTCGTGGAGACGAAGCGCGGTGCTGACTTCCTGGAGGACATGCTGTGCCGTGAAGGTTTCCCGGCTACGTCGATCCACGGCGACCGCT
CGCAGCGTGAGCGTGAGCAGGCTCTGGCTAGCTTCAAGTCGGGCCGCACGCCCGTTTTGGTGGCTACGGATGTGGCTGCCCGTGGTCTTGATATCGATGG
TGTGACCCAGGTTATTAACTTCGACCTGCCCAACAACATCGACGACTACGTCCACCGTATCGGTCGCACTGGTCGTGTGGGTAATATCGGTTACGCACTC
TCGATgatgaacgagaagaaccgcAACATCGCTCGCGAGATGTACGACATGATGGCGGAGAACGGACAGGAGATCCCGGCTTTCCTGGACCAGATGGCGA
CCAGCGGATAccgtggtggaggcggcggtCGTGGCCGCGGTGGccgtggtggccgtggcAGCTCCCGCTTCGGCGCTAAAGATTTCCGTAACGAAGAGCG
TGGCGGGGGCAGccgtggcggcggtggtggcttcggtggcggcggctacggcggtggtggctacggcggtggcggtggtggtggctacAGCGGCGGCAGC
CGTAGCGGTGGCTCCCGTGGTGGAGGCTTTAGCGACGACAACAGTGCCTGGTAA